P2Y9 (LPAR4) (NM_001278000) Human Untagged Clone

CAT#: SC335679

LPAR4 (untagged) - Human lysophosphatidic acid receptor 4 (LPAR4), transcript variant 1


  "NM_001278000" in other vectors (2)

Reconstitution Protocol

USD 503.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Anti-LPAR4 Rabbit Polyclonal Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "P2Y9"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol P2Y9
Synonyms GPR23; LPA4; P2RY9; P2Y5-LIKE; P2Y9
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001278000, the custom clone sequence may differ by one or more nucleotides


ATGGGTGACAGAAGATTCATTGACTTCCAATTCCAAGATTCAAATTCAAGCCTCAGACCCAGGTTGGGCA
ATGCTACTGCCAATAATACTTGCATTGTTGATGATTCCTTCAAGTATAATCTCAATGGTGCTGTCTACAG
TGTTGTATTCATCTTGGGTCTGATAACCAACAGTGTCTCTCTGTTTGTCTTCTGTTTCCGCATGAAAATG
AGAAGTGAGACTGCTATTTTTATCACCAATCTAGCTGTCTCTGATTTGCTTTTTGTCTGTACACTACCTT
TTAAAATATTTTACAACTTCAACCGCCACTGGCCTTTTGGTGACACCCTCTGCAAGATCTCTGGAACTGC
ATTCCTTACCAACATCTATGGGAGCATGCTCTTTCTCACCTGTATTAGTGTGGATCGTTTCCTGGCCATT
GTCTATCCTTTTCGATCTCGTACTATTAGGACTAGGAGGAATTCTGCCATTGTGTGTGCTGGTGTCTGGA
TCCTAGTCCTCAGTGGCGGTATTTCAGCCTCTTTGTTTTCCACCACTAATGTCAACAATGCAACCACCAC
CTGCTTTGAAGGCTTCTCCAAACGTGTCTGGAAGACTTATTTATCCAAGATCACAATATTTATTGAAGTT
GTTGGGTTTATCATTCCTCTAATATTGAATGTCTCTTGCTCTTCTGTGGTGCTGAGAACTCTTCGCAAGC
CTGCTACTCTGTCTCAAATTGGGACCAATAAGAAAAAAGTACTGAAAATGATCACAGTACATATGGCAGT
CTTTGTGGTATGCTTTGTACCCTACAACTCTGTCCTCTTCTTGTATGCCCTGGTGCGCTCCCAAGCTATT
ACTAATTGCTTTTTGGAAAGATTTGCAAAGATCATGTACCCAATCACCTTGTGCCTTGCAACTCTGAACT
GTTGTTTTGACCCTTTCATCTATTACTTCACCCTTGAATCCTTTCAGAAGTCCTTCTACATCAATGCCCA
CATCAGAATGGAGTCCCTGTTTAAGACTGAAACACCTTTGACCACAAAGCCTTCCCTTCCAGCTATTCAA
GAGGAAGTGAGTGATCAAACAACAAATAATGGTGGTGAATTAATGCTAGAATCCACCTTTTAG


Restriction Sites SgfI-MluI     
ACCN NM_001278000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278000.1, NP_001264929.1
RefSeq Size 2155 bp
RefSeq ORF 1113 bp
Locus ID 2846
UniProt ID Q99677
Cytogenetics Xq21.1
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary This gene encodes a member of the lysophosphatidic acid receptor family. It may also be related to the P2Y receptors, a family of receptors that bind purine and pyrimidine nucleotides and are coupled to G proteins. The encoded protein may play a role in monocytic differentiation. [provided by RefSeq, Feb 2009]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.