KLF5 (NM_001286818) Human Untagged Clone

CAT#: SC335638

KLF5 (untagged) - Human Kruppel-like factor 5 (intestinal) (KLF5), transcript variant 2


  "NM_001286818" in other vectors (2)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
KLF5 mouse monoclonal antibody,clone OTI6D2
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "KLF5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KLF5
Synonyms BTEB2; CKLF; IKLF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335638 representing NM_001286818.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGAAGTATCTGACACCTCAGCTTCCTCCAGTTCCTATAATTCCAGAGCATAAAAAGTATAGACGA
GACAGTGCCTCAGTCGTAGACCAGTTCTTCACTGACACTGAAGGGTTACCTTACAGTATCAACATGAAC
GTCTTCCTCCCTGACATCACTCACCTGAGAACTGGCCTCTACAAATCCCAGAGACCGTGCGTAACACAC
ATCAAGACAGAACCTGTTGCCATTTTCAGCCACCAGAGTGAAACGACTGCCCCTCCTCCGGCCCCGACC
CAGGCCCTCCCTGAGTTCACCAGTATATTCAGCTCACACCAGACCGCAGCTCCAGAGGTGAACAATATT
TTCATCAAACAAGAACTTCCTACACCAGATCTTCATCTTTCTGTCCCTACCCAGCAGGGCCACCTGTAC
CAGCTACTGAATACACCGGATCTAGATATGCCCAGTTCTACAAATCAGACAGCAGCAATGGACACTCTT
AATGTTTCTATGTCAGCTGCCATGGCAGGCCTTAACACACACACCTCTGCTGTTCCGCAGACTGCAGTG
AAACAATTCCAGGGCATGCCCCCTTGCACATACACAATGCCAAGTCAGTTTCTTCCACAACAGGCCACT
TACTTTCCCCCGTCACCACCAAGCTCAGAGCCTGGAAGTCCAGATAGACAAGCAGAGATGCTCCAGAAT
TTAACCCCACCTCCATCCTATGCTGCTACAATTGCTTCTAAACTGGCAATTCACAATCCAAATTTACCC
ACCACCCTGCCAGTTAACTCACAAAACATCCAACCTGTCAGATACAATAGAAGGAGTAACCCCGATTTG
GAGAAACGACGCATCCACTACTGCGATTACCCTGGTTGCACAAAAGTTTATACCAAGTCTTCTCATTTA
AAAGCTCACCTGAGGACTCACACTGGTGAAAAGCCATACAAGTGTACCTGGGAAGGCTGCGACTGGAGG
TTCGCGCGATCGGATGAGCTGACCCGCCACTACCGGAAGCACACAGGCGCCAAGCCCTTCCAGTGCGGG
GTGTGCAACCGCAGCTTCTCGCGCTCTGACCACCTGGCCCTGCATATGAAGAGGCACCAGAACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001286818
Insert Size 1101 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286818.1
RefSeq Size 2969 bp
RefSeq ORF 1101 bp
Locus ID 688
UniProt ID Q13887
Cytogenetics 13q22.1
Protein Families Embryonic stem cells, ES Cell Differentiation/IPS, Induced pluripotent stem cells, Transcription Factors
MW 41.2 kDa
Gene Summary This gene encodes a member of the Kruppel-like factor subfamily of zinc finger proteins. The encoded protein is a transcriptional activator that binds directly to a specific recognition motif in the promoters of target genes. This protein acts downstream of multiple different signaling pathways and is regulated by post-translational modification. It may participate in both promoting and suppressing cell proliferation. Expression of this gene may be changed in a variety of different cancers and in cardiovascular disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
Transcript Variant: This variant (2, also known as tKLF5) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.