STK25 (NM_001282306) Human Untagged Clone

CAT#: SC335552

STK25 (untagged) - Human serine/threonine kinase 25 (STK25), transcript variant 3


  "NM_001282306" in other vectors (2)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal antibody to STK25 (serine/threonine kinase 25 (STE20 homolog, yeast))
    • 100 ul

USD 625.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "STK25"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol STK25
Synonyms SOK1; YSK1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335552 representing NM_001282306.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGATCGAGGACATCCAGCAGGAGATCACTGTCCTCAAGCACCAAGCTATGGATCATCATGGAGTAC
CTGGGCGGCGGCTCAGCACTGGACTTGCTTAAACCAGGTCCCCTGGAGGAGACATACATTGCCACGATC
CTGCGGGAGATTCTGAAGGGCCTGGATTATCTGCACTCCGAACGCAAGATCCACCGAGACATCAAAGCT
GCCAACGTGCTACTCTCGGAGCAGGGTGACGTGAAGCTGGCGGACTTTGGGGTAGCAGGGCAGCTCACA
GACACGCAGATTAAGAGGAACACATTCGTGGGCACCCCCTTCTGGATGGCACCTGAGGTCATCAAGCAG
TCGGCCTACGACTTCAAGGCTGACATCTGGTCCCTGGGGATCACAGCCATCGAGCTGGCCAAGGGGGAG
CCTCCAAACTCTGACCTCCACCCCATGCGCGTCCTGTTCCTGATTCCCAAGAACAGCCCACCCACACTG
GAGGGCCAGCACAGCAAGCCCTTCAAGGAGTTCGTGGAGGCCTGCCTCAACAAAGACCCCCGATTCCGG
CCCACGGCCAAGGAGCTCCTGAAGCACAAGTTCATCACACGCTACACCAAGAAGACCTCCTTCCTCACG
GAGCTCATCGACCGCTATAAGCGCTGGAAGTCAGAGGGGCATGGCGAGGAGTCCAGCTCTGAGGACTCT
GACATTGATGGCGAGGCGGAGGACGGGGAGCAGGGCCCCATCTGGACGTTCCCCCCTACCATCCGGCCG
AGTCCACACAGCAAGCTTCACAAGGGGACGGCCCTGCACAGTTCACAGAAGCCTGCGGAGCCCGTCAAG
AGGCAGCCGAGGTCCCAGTGCCTGTCCACGCTGGTCCGGCCCGTCTTCGGAGAGCTCAAAGAGAAGCAC
AAGCAGAGCGGCGGGAGCGTGGGTGCGCTGGAGGAGCTGGAGAACGCCTTCAGCCTGGCCGAGGAGTCC
TGCCCCGGCATCTCAGACAAGCTGATGGTGCACCTGGTGGAGCGAGTGCAGAGGTTTTCACACAACAGA
AACCACCTGACATCCACCCGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001282306
Insert Size 1059 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282306.1
RefSeq Size 2539 bp
RefSeq ORF 1059 bp
Locus ID 10494
Cytogenetics 2q37.3
Protein Families Druggable Genome, Protein Kinase
MW 39.6 kDa
Gene Summary This gene encodes a member of the germinal centre kinase III (GCK III) subfamily of the sterile 20 superfamily of kinases. The encoded enzyme plays a role in serine-threonine liver kinase B1 (LKB1) signaling pathway to regulate neuronal polarization and morphology of the Golgi apparatus. The protein is translocated from the Golgi apparatus to the nucleus in response to chemical anoxia and plays a role in regulation of cell death. A pseudogene associated with this gene is located on chromosome 18. Multiple alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2012]
Transcript Variant: This variant (3) differs in the 5' UTR and uses an alternate splice site in the 5' coding region, compared to variant 1. These differences cause translation initiation at an alternate AUG and result in an isoform (4) with a shorter and distinct N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.