FDFT1 (NM_001287751) Human Untagged Clone

CAT#: SC335393

FDFT1 (untagged) - Human farnesyl-diphosphate farnesyltransferase 1 (FDFT1), transcript variant 10


  "NM_001287751" in other vectors (2)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
FDFT1 mouse monoclonal antibody, clone OTI2F10 (formerly 2F10)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "FDFT1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FDFT1
Synonyms DGPT; ERG9; SQS; SQSD; SS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335393 representing NM_001287751.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACCATCAGTGTGGAAAAGAAGGTCCCGCTGTTACACAACTTTCACTCTTTCCTTTACCAACCAGAC
TGGCGGTTCATGGAGAGCAAGGAGAAGGATCGCCAGGTGCTGGAGGACTTCCCAACGATCTCCCTTGAG
TTTAGAAATCTGGCTGAGAAATACCAAACAGTGATTGCCGACATTTGCCGGAGAATGGGCATTGGGATG
GCAGAGTTTTTGGATAAGCATGTGACCTCTGAACAGGAGTGGGACAAGTACTGCCACTATGTTGCTGGG
CTGGTCGGAATTGGCCTTTCCCGTCTTTTCTCAGCCTCAGAGTTTGAAGACCCCTTAGTTGGTGAAGAT
ACAGAACGTGCCAACTCTATGGGCCTGTTTCTGCAGAAAACAAACATCATCCGTGACTATCTGGAAGAC
CAGCAAGGAGGAAGAGAGTTCTGGCCTCAAGAGGTTTGGAGCAGGTATGTTAAGAAGTTAGGGGATTTT
GCTAAGCCGGAGAATATTGACTTGGCCGTGCAGTGCCTGAATGAACTTATAACCAATGCACTGCACCAC
ATCCCAGATGTCATCACCTACCTTTCGAGACTCAGAAACCAGAGTGTGTTTAACTTCTGTGCTATTCCA
CAGGTGATGGCCATTGCCACTTTGGCTGCCTGTTATAATAACCAGCAGGTGTTCAAAGGGGCAGTGAAG
ATTCGGAAAGGGCAAGCAGTGACCCTGATGATGGATGCCACCAATATGCCAGCTGTCAAAGCCATCATA
TATCAGTATATGGAAGAGATTTATCATAGAATCCCCGACTCAGACCCATCTTCTAGCAAAACAAGGCAG
ATCATCTCCACCATCCGGACGCAGAATCTTCCCAACTGTCAGCTGATTTCCCGAAGCCACTACTCCCCC
ATCTACCTGTCGTTTGTCATGCTTTTGGCTGCCCTGAGCTGGCAGTACCTGACCACTCTCTCCCAGGTA
ACAGAAGACTATGTTCAGACTGGAGAACACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001287751
Insert Size 999 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001287751.1
RefSeq Size 2120 bp
RefSeq ORF 999 bp
Locus ID 2222
UniProt ID P37268
Cytogenetics 8p23.1
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Steroid biosynthesis
MW 38.3 kDa
Gene Summary This gene encodes a membrane-associated enzyme located at a branch point in the mevalonate pathway. The encoded protein is the first specific enzyme in cholesterol biosynthesis, catalyzing the dimerization of two molecules of farnesyl diphosphate in a two-step reaction to form squalene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (10) lacks several exons from the 5' end, contains an alternate 5' terminal exon, and initiates translation from an in-frame downstream start codon compared to variant 1. The resulting isoform (4) has a shorter N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.