LMCD1 (NM_001278235) Human Untagged Clone
CAT#: SC334800
LMCD1 (untagged) - Human LIM and cysteine-rich domains 1 (LMCD1), transcript variant 4
"NM_001278235" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "LMCD1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | LMCD1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001278235, the custom clone sequence may differ by one or more nucleotides
ATGGCAAAGGTGGCTAAGGACCTCAACCCAGGAGTTAAAAAGATGTCCCTGGGCCAGCTGCAGTCAGCAA GAGGTGTGGCATGTTTGGGATGCAAGGGGACGTGTTCGGGCTTCGAGCCACATTCATGGAGGAAAATATG CAAGTCTTGCAAATGCAGCCAAGAGGACCACTGCCTAACATCTGACCTAGAAGACGATCGGAAAATTGGC CGCTTGCTGATGGACTCCAAGTATTCCACCCTCACTGCTCGGGTGAAAGGCGGGGACGGCATCCGGATTT ACAAGAGGAACCGGATGATCATGACCAACCCTATTGCTACTGGGAAAGATCCCACTTTTGACACCATCAC CTACGAGTGGGCTCCCCCTGGAGTCACCCAGAAACTGGGACTGCAGTACATGGAGCTCATCCCCAAGGAG AAGCAGCCAGTGACAGGCACAGAGGGTGCCTTTTACCGCCGCCGCCAGCTCATGCACCAGCTCCCCATCT ATGACCAGGATCCCTCGCGCTGCCGTGGACTTTTGGAGAATGAGTTGAAACTGATGGAAGAATTTGTCAA GCAATATAAGAGCGAGGCCCTCGGCGTGGGAGAAGTGGCCCTCCCGGGGCAGGGTGGCTTGCCCAAGGAG GAGGGGAAGCAGCAGGAAAAGCCAGAGGGGGCAGAGACCACTGCTGCTACCACCAACGGCAGTCTCAGTG ACCCGTCCAAAGAAGTGGAATACAAGCCAGTCCCACTCGTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278235 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001278235.1, NP_001265164.1 |
RefSeq Size | 2261 bp |
RefSeq ORF | 744 bp |
Locus ID | 29995 |
UniProt ID | Q9NZU5 |
Cytogenetics | 3p25.3 |
Gene Summary | This gene encodes a member of the LIM-domain family of zinc finger proteins. The encoded protein contains an N-terminal cysteine-rich domain and two C-terminal LIM domains. The presence of LIM domains suggests involvement in protein-protein interactions. The protein may act as a co-regulator of transcription along with other transcription factors. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013] Transcript Variant: This variant (4) contains an alternate 3' terminal exon which results in an early stop codon, compared to variant 1. It encodes isoform 4, which has a shorter and distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.