IFNAR2 (NM_001289126) Human Untagged Clone

CAT#: SC334723

IFNAR2 (untagged) - Human interferon (alpha, beta and omega) receptor 2 (IFNAR2), transcript variant 5


  "NM_001289126" in other vectors (2)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
IFNAR2 Rabbit Polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "IFNAR2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IFNAR2
Synonyms IFN-alpha-REC; IFN-R; IFNABR; IFNARB; IMD45
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001289126, the custom clone sequence may differ by one or more nucleotides


ATGCTTTTGAGCCAGAATGCCTTCATCTTCAGATCACTTAATTTGGTTCTCATGGTGTATATCAGCCTCG
TGTTTGGTATTTCATATGATTCGCCTGATTACACAGATGAATCTTGCACTTTCAAGATATCATTGCGAAA
TTTCCGGTCCATCTTATCATGGGAATTAAAAAACCACTCCATTGTACCAACTCACTATACATTGCTGTAT
ACAATCATGAGTAAACCAGAAGATTTGAAGGTGGTTAAGAACTGTGCAAATACCACAAGATCATTTTGTG
ACCTCACAGATGAGTGGAGAAGCACACACGAGGCCTATGTCACCGTCCTAGAAGGATTCAGCGGGAACAC
AACGTTGTTCAGTTGCTCACACAATTTCTGGCTGGCCATAGACATGTCTTTTGAACCACCAGAGTTTGAG
ATTGTTGGTTTTACCAACCACATTAATGTGATGGTGAAATTTCCATCTATTGTTGAGGAAGAATTACAGT
TTGATTTATCTCTCGTCATTGAAGAACAGTCAGAGGGAATTGTTAAGAAGCATAAACCCGAAATAAAAGG
AAACATGAGTGGAAATTTCACCTATATCATTGACAAGTTAATTCCAAACACGAACTACTGTGTATCTGTT
TATTTAGAGCACAGTGATGAGCAAGCAGTAATAAAGTCTCCCTTAAAATGCACCCTCCTTCCACCTGGCC
AGGAATCAGAATTTTCATAA


Restriction Sites SgfI-MluI     
ACCN NM_001289126
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289126.1, NP_001276055.1
RefSeq Size 2789 bp
RefSeq ORF 720 bp
Locus ID 3455
UniProt ID P48551
Cytogenetics 21q22.11
Protein Families Druggable Genome, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway, Natural killer cell mediated cytotoxicity, Toll-like receptor signaling pathway
Gene Summary The protein encoded by this gene is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. The protein belongs to the type II cytokine receptor family. Mutations in this gene are associated with Immunodeficiency 45. [provided by RefSeq, Jul 2020]
Transcript Variant: This variant (5) lacks an alternate in-frame exon, which results in a frameshift and early termination of translation, compared to variant 1. The encoded protein (isoform c) has a shorter and distinct C-terminus, compared to isoform a. Variants 5 and 6 both encode isoform c. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.