CDK2 (NM_001290230) Human Untagged Clone
CAT#: SC334717
CDK2 (untagged) - Human cyclin-dependent kinase 2 (CDK2), transcript variant 3
"NM_001290230" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "CDK2"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CDK2 |
Synonyms | CDKN2; p33(CDK2) |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001290230, the custom clone sequence may differ by one or more nucleotides
ATGGAGAACTTCCAAAAGGTGGAAAAGATCGGAGAGGGCACGTACGGAGTTGTGTACAAAGCCAGAAACA AGTTGACGGGAGAGGTGGTGGCGCTTAAGAAAATCCGCCTGGACACGCTGCTGGATGTCATTCACACAGA AAATAAACTCTACCTGGTTTTTGAATTTCTGCACCAAGATCTCAAGAAATTCATGGATGCCTCTGCTCTC ACTGGCATTCCTCTTCCCCTCATCAAGAGCTATCTGTTCCAGCTGCTCCAGGGCCTAGCTTTCTGCCATT CTCATCGGGTCCTCCACCGAGACCTTAAACCTCAGAATCTGCTTATTAACACAGAGGGGGCCATCAAGCT AGCAGACTTTGGACTAGCCAGAGCTTTTGGAGTCCCTGTTCGTACTTACACCCATGAGGTGACTCGCCGG GCCCTATTCCCTGGAGATTCTGAGATTGACCAGCTCTTCCGGATCTTTCGGACTCTGGGGACCCCAGATG AGGTGGTGTGGCCAGGAGTTACTTCTATGCCTGATTACAAGCCAAGTTTCCCCAAGTGGGCCCGGCAAGA TTTTAGTAAAGTTGTACCTCCCCTGGATGAAGATGGACGGAGCTTGTTATCGCAAATGCTGCACTACGAC CCTAACAAGCGGATTTCGGCCAAGGCAGCCCTGGCTCACCCTTTCTTCCAGGATGTGACCAAGCCAGTAC CCCATCTTCGACTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001290230 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001290230.1, NP_001277159.1 |
RefSeq Size | 2121 bp |
RefSeq ORF | 717 bp |
Locus ID | 1017 |
UniProt ID | P24941 |
Cytogenetics | 12q13.2 |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | Cell cycle, Oocyte meiosis, p53 signaling pathway, Pathways in cancer, Progesterone-mediated oocyte maturation, Prostate cancer, Small cell lung cancer |
Gene Summary | This gene encodes a member of a family of serine/threonine protein kinases that participate in cell cycle regulation. The encoded protein is the catalytic subunit of the cyclin-dependent protein kinase complex, which regulates progression through the cell cycle. Activity of this protein is especially critical during the G1 to S phase transition. This protein associates with and regulated by other subunits of the complex including cyclin A or E, CDK inhibitor p21Cip1 (CDKN1A), and p27Kip1 (CDKN1B). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014] Transcript Variant: This variant (3) lacks two alternate in-frame exons, compared to variant 1. The encoded isoform (3) is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.