RHOH (NM_001278368) Human Untagged Clone

CAT#: SC334340

RHOH (untagged) - Human ras homolog family member H (RHOH), transcript variant 11

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RHOH
• Synonyms: ARHH; TTF
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001278368, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTGAGTTCCATCAAGTGCGTGTTGGTGGGCGACTCTGCTGTGGGGAAAACCTCTCTGTTGGTGCGCT
  TCACCTCCGAGACCTTCCCGGAGGCCTACAAGCCCACAGTGTACGAGAACACAGGGGTGGACGTCTTCAT
  GGATGGCATCCAGATCAGCCTGGGCCTCTGGGACACAGCCGGCAATGACGCCTTCAGAAGCATCCGGCCC
  CTGTCCTACCAGCAGGCAGACGTGGTGCTGATGTGCTACTCTGTGGCCAACCATAACTCATTCCTGAACT
  TGAAGAACAAGTGGATTGGTGAAATTAGGAGCAACTTGCCCTGTACCCCTGTGCTGGTGGTGGCCACCCA
  GACTGACCAGCGGGAGATGGGGCCCCACAGGGCCTCCTGCGTCAATGCCATGGAAGGGAAGAAACTGGCC
  CAGGATGTCAGAGCCAAGGGCTACCTGGAGTGCTCAGCCCTTAGCAATCGGGGAGTACAGCAGGTGTTTG
  AGTGCGCCGTCCGAACTGCCGTCAACCAGGCCAGGAGACGAAACAGAAGGAGGCTCTTCTCCATCAATGA
  GTGCAAGATCTTCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001278368
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278368.1, NP_001265297.1
• RefSeq Size: 2036 bp
• RefSeq ORF: 576 bp
• Locus ID: 399
• UniProt ID: Q15669
• Cytogenetics: 4p14
• Protein Families: Transcription Factors
• Protein Pathways: Leukocyte transendothelial migration
• Gene Summary: The protein encoded by this gene is a member of the Ras superfamily of guanosine triphosphate (GTP)-metabolizing enzymes. The encoded protein is expressed in hematopoietic cells, where it functions as a negative regulator of cell growth and survival. This gene may be hypermutated or misexpressed in leukemias and lymphomas. Chromosomal translocations in non-Hodgkin's lymphoma occur between this locus and B-cell CLL/lymphoma 6 (BCL6) on chromosome 3, leading to the production of fusion transcripts. Alternative splicing in the 5' untranslated region results in multiple transcript variants that encode the same protein. [provided by RefSeq, May 2013]
  Transcript Variant: This variant (11) contains an alternate 5' exon and lacks two exons in the 5' UTR, compared to variant 1. Variants 1 through 12 encode the same protein.