COA8 (NM_001302653) Human Untagged Clone

CAT#: SC334319

APOPT1 (untagged) - Human apoptogenic 1, mitochondrial (APOPT1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: COA8
• Synonyms: APOP; APOP1; APOPT1; C14orf153; MC4DN17
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001302653, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTGCCGTGCGCCGCGGGAGCCAGGGGGCGTGGGGCCATGGTGGTCTTGCGGGCGGGGAAGAAGACCT
  TTCTCCCCCCTCTCTGCCGCGCCTTCGCCTGCCGCGGCTGTCAACTCGCTCCGGAGCGCGGCGCCGAGCG
  CAGGGATACGGCGCCCAGCGGGGTCTCAAGATTCTGCCCTCCAAGAAAGTCTTGCCATGATTGGATAGGA
  CCCCCAGATAAATATTCAAACCTTCGACCTGTTCACTTTTACATACCTGAAAATGAATCTCCATTGGAAC
  AAAAGCTTAGAAAATTAAGACAAGAAACACAAGAATGGAATCAACAGTTCTGGGCAAACCAGAATTTGAC
  TTTTAGTAAGGAAAAAGAAGAATTTATTCACTCAAGACTAAAAACTAAAGGCCTGGGCCTGAGAACTGAA
  TCAGACCCCACTTTACCTCGGGTAACTGAAACCATGGAAAGAAAAACCATGGATGGAGGGGACAGCTGTG
  CTGCCGCCATCTCCCTTACACAGTCAGAAAGCAACATTGAATGCAGAAGAAATGGCGGACTTCTACAAGG
  AATTTTTAAGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001302653
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001302653.1, NP_001289582.1
• RefSeq Size: 1337 bp
• RefSeq ORF: 573 bp
• Locus ID: 84334
• UniProt ID: Q96IL0
• Cytogenetics: 14q32.33
• Protein Families: Secreted Protein
• Gene Summary: This gene encodes a protein that localizes to the mitochondria, where it stimulates the release of cytochrome c, thereby promoting programmed cell death. Mutations in this gene have been found in individuals with mitochondrial complex IV deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
  Transcript Variant: This variant (3) has a shorter 3' UTR, and contains an alternate exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (3) has a distinct, shorter C-terminus than isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.