Calcipressin 1 (RCAN1) (NM_001285389) Human Untagged Clone
CAT#: SC334144
RCAN1 (untagged) - Human regulator of calcineurin 1 (RCAN1), transcript variant 4
"NM_001285389" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "RCAN1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RCAN1 |
Synonyms | ADAPT78; CSP1; DSC1; DSCR1; MCIP1; RCN1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001285389, the custom clone sequence may differ by one or more nucleotides
ATGGTGTATGCCAAATTTGAGTCCCTCTTTAGGACGTATGACAAGGACATCACCTTTCAGTATTTTAAGA GCTTCAAACGAGTCAGAATAAACTTCAGCAACCCCTTCTCCGCAGCAGATGCCAGGCTCCAGCTGCATAA GACTGAGTTTCTGGGAAAGGAAATGAAGTTATATTTTGCTCAGACCTTACACATAGGAAGCTCACACCTG GCTCCGCCAAATCCAGACAAGCAGTTTCTGATCTCCCCTCCCGCCTCTCCGCCAGTGGGATGGAAACAAG TGGAAGATGCGACCCCAGTCATAAACTATGATCTCTTATATGCCATCTCCAAGCTGGGGCCAGGGGAAAA GTATGAATTGCACGCAGCGACTGACACCACTCCCAGCGTGGTGGTCCATGTATGTGAGAGTGATCAAGAG AAGGAGGAAGAAGAGGAAATGGAAAGAATGAGGAGACCTAAGCCAAAAATTATCCAGACCAGGAGGCCGG AGTACACGCCGATCCACCTCAGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001285389 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001285389.2, NP_001272318.1 |
RefSeq Size | 2210 bp |
RefSeq ORF | 516 bp |
Locus ID | 1827 |
UniProt ID | P53805 |
Cytogenetics | 21q22.12 |
Protein Families | Transcription Factors |
Gene Summary | The protein encoded by this gene interacts with calcineurin A and inhibits calcineurin-dependent signaling pathways, possibly affecting central nervous system development. This gene is located in the minimal candidate region for the Down syndrome phenotype, and is overexpressed in the brain of Down syndrome fetuses. Chronic overexpression of this gene may lead to neurofibrillary tangles such as those associated with Alzheimer disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013] Transcript Variant: This variant (4) uses an alternate 5' exon compared to variant 1. The resulting isoform (d) has a distinct N-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.