Proteasome subunit alpha type 6 (PSMA6) (NM_001282233) Human Untagged Clone

CAT#: SC334113

PSMA6 (untagged) - Human proteasome (prosome, macropain) subunit, alpha type, 6 (PSMA6), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: Proteasome subunit alpha type 6
• Synonyms: IOTA; p27K; PROS27
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334113 representing NM_001282233.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGACCGGAATGACAGCTGACAGCAGATCCCAGGTACAGAGGGCACGCTATGAGGCAGCTAACTGGAAA
  TACAAGTATGGCTATGAGATTCCTGTGGACATGCTGTGTAAAAGAATTGCCGATATTTCTCAGGTCTAC
  ACACAGAATGCTGAAATGAGGCCTCTTGGTTGTTGTATGATTTTAATTGGTATAGATGAAGAGCAAGGC
  CCTCAGGTATATAAGTGTGATCCTGCAGGTTACTACTGTGGGTTTAAAGCCACTGCAGCGGGAGTTAAA
  CAAACTGAGTCAACCAGCTTCCTTGAAAAAAAAGTGAAGAAGAAATTTGATTGGACATTTGAACAGACA
  GTGGAAACTGCAATTACATGCCTGTCTACTGTTCTATCAATTGATTTCAAACCTTCAGAAATAGAAGTT
  GGAGTAGTGACAGTTGAAAATCCTAAATTCAGGATTCTTACAGAAGCAGAGATTGATGCTCACCTTGTT
  GCTCTAGCAGAGAGAGACTAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001282233
• Insert Size: 504 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001282233.1
• RefSeq Size: 996 bp
• RefSeq ORF: 504 bp
• Locus ID: 5687
• UniProt ID: P60900
• Cytogenetics: 14q13.2
• Protein Families: Druggable Genome, Protease, Stem cell - Pluripotency
• Protein Pathways: Proteasome
• MW: 18.8 kDa
• Gene Summary: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Multiple transcript variants encoding several different isoforms have been found for this gene. A pseudogene has been identified on the Y chromosome. [provided by RefSeq, Aug 2013]
  Transcript Variant: This variant (3) lacks an alternate exon compared to variant 1. This difference causes translation initiation at a downstream AUG and results in an isoform (b) with a shorter N-terminus compared to isoform a. Variants 2 and 3 both encode the same isoform (b).