NMU (NM_001292045) Human Untagged Clone

CAT#: SC334044

NMU (untagged) - Human neuromedin U (NMU), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NMU
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334044 representing NM_001292045.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGCTGCGAACAGAGAGCTGCCGCCCCAGGTCGCCCGCCGGACAGGTGGCCGCGGCGTCCCCGCTCCTG
  CTGCTGCTGCTGCTGCTCGCCTGGTGCGCGGGCGCCTGCCGAGGTGCTCCAATATTACCTCAAGGATTA
  CAGCCTGAACAACAGCTACAGTTGTGGAATGAGGCATCCAACGCACTGGAGGAGCTTTGCTTTATGATT
  ATGGGAATGCTACCAAAGCCTCAGGAACAAGATGAAAAAGATAATACTAAAAGGTTCTTATTTCATTAT
  TCGAAGACACAGAAGTTGGGCAAGTCAAATGTTGTGTCGTCAGTTGTGCATCCGTTGCTGCAGCTCGTT
  CCTCACCTGCATGAGAGAAGAATGAAGAGATTCAGAGTGGACGAAGAATTCCAAAGTCCCTTTGCAAGT
  CAAAGTCGAGGATATTTTTTATTCAGGCCACGGAATGGAAGAAGGTCAGCAGGGTTCATTTAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001292045
• Insert Size: 477 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001292045.1
• RefSeq Size: 786 bp
• RefSeq ORF: 477 bp
• Locus ID: 10874
• UniProt ID: P48645
• Cytogenetics: 4q12
• Protein Families: Druggable Genome, Secreted Protein, Transmembrane
• MW: 18 kDa
• Gene Summary: This gene encodes a member of the neuromedin family of neuropeptides. The encoded protein is a precursor that is proteolytically processed to generate a biologically active neuropeptide that plays a role in pain, stress, immune-mediated inflammatory diseases and feeding regulation. Increased expression of this gene was observed in renal, pancreatic and lung cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. Some of these isoforms may undergo similar processing to generate the mature peptide. [provided by RefSeq, Jul 2015]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. It encodes isoform 2, which lacks an internal segment and is shorter than isoform 1. This isoform (2) may undergo processing similar to isoform 1 to generate mature peptide.