RANTES (CCL5) (NM_001278736) Human Untagged Clone

CAT#: SC334003

CCL5 (untagged) - Human chemokine (C-C motif) ligand 5 (CCL5), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RANTES
• Synonyms: D17S136E; eoCP; RANTES; SCYA5; SIS-delta; SISd; TCP228
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001278736, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGGTCTCCGCGGCAGCCCTCGCTGTCATCCTCATTGCTACTGCCCTCTGCGCTCCTGCATCTGCCT
  CCCCATATTCCTCGGACACCACACCCTGCTGCTTTGCCTACATTGCCCGCCCACTGCCCCGTGCCCACAT
  CAAGGAGTATTTCTACACCAGTGGCAAGTGCTCCAACCCAGCAGTCGTCCACAGGTCAAGGATGCCAAAG
  AGAGAGGGACAGCAAGTCTGGCAGGATTTCCTGTATGACTCCCGGCTGAACAAGGGCAAGCTTTGTCACC
  CGAAAGAACCGCCAAGTGTGTGCCAACCCAGAGAAGAAATGGGTTCGGGAGTACATCAACTCTTTGGAGA
  TGAGCTAGGATGGAGAGTCCTTGAACCTGAACTTACACAAATTTGCCTGTTTCTGCTTGCTCTTGTCCTA
  GCTTGGGAGGCTTCCCCTCACTATCCTACCCCACCCGCTCCTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001278736
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278736.1, NP_001265665.1
• RefSeq Size: 1319 bp
• RefSeq ORF: 465 bp
• Locus ID: 6352
• Cytogenetics: 17q12
• Protein Families: Druggable Genome, Secreted Protein, Transmembrane
• Protein Pathways: Chemokine signaling pathway, Cytokine-cytokine receptor interaction, Cytosolic DNA-sensing pathway, Epithelial cell signaling in Helicobacter pylori infection, NOD-like receptor signaling pathway, Prion diseases, Toll-like receptor signaling pathway
• Gene Summary: This gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokines form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of the N-terminal cysteine residues of the mature peptide. This chemokine, a member of the CC subfamily, functions as a chemoattractant for blood monocytes, memory T helper cells and eosinophils. It causes the release of histamine from basophils and activates eosinophils. This cytokine is one of the major HIV-suppressive factors produced by CD8+ cells. It functions as one of the natural ligands for the chemokine receptor chemokine (C-C motif) receptor 5 (CCR5), and it suppresses in vitro replication of the R5 strains of HIV-1, which use CCR5 as a coreceptor. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]
  Transcript Variant: This variant (2) uses an alternate exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) has a longer and distinct C-terminus, compared to isoform 1.