NTAQ1 (NM_001283024) Human Untagged Clone

CAT#: SC333919

WDYHV1 (untagged) - Human WDYHV motif containing 1 (WDYHV1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NTAQ1
• Synonyms: C8orf32; WDYHV1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC333919 representing NM_001283024.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGATACCTATCTGGAAACAACAGGCGAGACCTGGAGATGGACCTGTGATCTGGGATTACCATGTTGTT
  TTGCTTCATGTTTCAAGTGGAGGACAGAACTTCATTTATGATCTCGATACTGTCTTGCCATTTCCCTGC
  CTCTTTGACACTTATGTAGAAGATGCCTTTAAGTCTGATGATGACATTCACCCACAGTTTAGGAGGAAA
  TTTAGAGTGATCCGTGCAGATTCATATTTGAAGAACTTTGCTTCTGACCGATCTCACATGAAAGACTCC
  AGTGGGAATTGGAGAGAGCCTCCGCCGCCATATCCCTGCATTGAGACTGGAGATTCCAAAATGAACCTG
  AACGATTTCATCAGTATGGATCCCAAGGTAGGATGGGGCGCCGTCTACACACTATCCGAATTTACACAT
  CGGTTTGGCAGTAAAAACTGCTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001283024
• Insert Size: 438 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001283024.1
• RefSeq Size: 1492 bp
• RefSeq ORF: 438 bp
• Locus ID: 55093
• UniProt ID: Q96HA8
• Cytogenetics: 8q24.13
• Protein Families: Stem cell - Pluripotency
• MW: 16.7 kDa
• Gene Summary: Mediates the side-chain deamidation of N-terminal glutamine residues to glutamate, an important step in N-end rule pathway of protein degradation. Conversion of the resulting N-terminal glutamine to glutamate renders the protein susceptible to arginylation, polyubiquitination and degradation as specified by the N-end rule. Does not act on substrates with internal or C-terminal glutamine and does not act on non-glutamine residues in any position. Does not deaminate acetylated N-terminal glutamine. With the exception of proline, all tested second-position residues on substrate peptides do not greatly influence the activity. In contrast, a proline at position 2, virtually abolishes deamidation of N-terminal glutamine.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) uses an alternate splice site in the 5' UTR which results in the use of a downstream start codon compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.