CNIH4 (NM_001277200) Human Untagged Clone

CAT#: SC333846

CNIH4 (untagged) - Human cornichon family AMPA receptor auxiliary protein 4 (CNIH4), transcript variant 5


  "NM_001277200" in other vectors (2)

Reconstitution Protocol

USD 165.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "CNIH4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CNIH4
Synonyms CNIH-4; CNIH2; HSPC163
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333846 representing NM_001277200.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGGCGGTGGTGTTCGTCTTCTCTCTCCTCGATTGTTGCGCGCTCATCTTCCTCTCGGTCTACTTC
ATAATTACATTGTCTGATTTAGAATGTGATTACATTAATGCTAGATCATGTTGCTCAAAATTAAACAAG
TGGGTAATTCCAGAATTGATTGGCCATACCATTGTCACTGTATTACTGCTCATGTCATTGCACTGGTTC
ATCTTCCTTCTCAACTTACCTGTTGCCACTTGGAATATATATCGATACATTATGGTGCCGAGTGGTAAC
ATGGGAGTGTTTGATCCAACAGAAATACACAATCGAGGGCAGCTGAAGTCACACATGAAAGAAGCCATG
ATCAAGCTTGGTTTCCACTTGCTCTGCTTCTTCATGTATCTTTATAGTGGTAGCAACTGCCCTTGCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001277200
Insert Size 414 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001277200.1
RefSeq Size 905 bp
RefSeq ORF 414 bp
Locus ID 29097
Cytogenetics 1q42.11
Protein Families Transmembrane
MW 15.8 kDa
Gene Summary Involved in G protein-coupled receptors (GPCRs) trafficking from the endoplasmic reticulum to the cell surface; it promotes the exit of GPCRs from the early secretory pathway, likely through interaction with the COPII machinery (PubMed:24405750).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) uses an alternate downstream exon in place of the last exon of variant 1. The resulting isoform (5) has a shorter and distinct C-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.