Macrophage Inflammatory Protein 1 beta (CCL4L2) (NM_001291472) Human Untagged Clone

CAT#: SC333468

CCL4L2 (untagged) - Human chemokine (C-C motif) ligand 4-like 2 (CCL4L2), transcript variant CCL4L2d

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: Macrophage Inflammatory Protein 1 beta
• Synonyms: AT744.2; CCL4L; SCYA4L; SCYQ4L2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC333468 representing NM_001291472.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAAGCTCTGCGTGACTGTCCTGTCTCTCCTCGTGCTAGTAGCTGCCTTCTGCTCTCTAGCACTCTCA
  GCACCAATGGGCTCAGACCCTCCCACCGCCTGCTGCTTTTCTTACACCGCGAGGAAGCTTCCTCGCAAC
  TTTGTGGTAGATTACTATGAGACCAGCAGCCTCTGCTCCCAGCCAGCTGTGGTTGCTGCTCCGGGAAGG
  ATCCCATCCACCAGAGCTGCCCCACATGGACCATGGTCAGGCAGAGGAAGATGCCTACCACAGGCAAGG
  GATAAAGCCAGATGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001291472
• Insert Size: 291 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001291472.1
• RefSeq Size: 815 bp
• RefSeq ORF: 291 bp
• Locus ID: 9560
• UniProt ID: Q8NHW4
• Cytogenetics: 17q12
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Chemokine signaling pathway, Cytokine-cytokine receptor interaction, Cytosolic DNA-sensing pathway
• MW: 10.2 kDa
• Gene Summary: This gene is one of several cytokine genes that are clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins that function in inflammatory and immunoregulatory processes. The protein encoded by this family member is similar to the chemokine (C-C motif) ligand 4 product, which inhibits HIV entry by binding to the cellular receptor CCR5. The copy number of this gene varies among individuals, where most individuals have one to five copies. This gene copy contains a non-consensus splice acceptor site at the 3' terminal exon found in other highly similar gene copies, and it thus uses other alternative splice sites for the 3' terminal exon, resulting in multiple transcript variants. [provided by RefSeq, Apr 2014]
  Transcript Variant: This variant (CCL4L2d) uses an alternate splice site in the 3' terminal exon, and it thus differs in the 3' coding region and 3' UTR, compared to variant CCL4L2. The encoded isoform (4) has a distinct C-terminus and is longer than isoform 1.