UQCRH (NM_001297566) Human Untagged Clone

CAT#: SC333405

UQCRH (untagged) - Human ubiquinol-cytochrome c reductase hinge protein (UQCRH), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: UQCRH
• Synonyms: QCR6; UQCR8
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC333405 representing NM_001297566.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGGACTGGAGGACGAGCAAAAGATGCTTACCGAATCCGGAGATCCTGAGGAGGATCCCCTAACAACA
  GTGAGAGAGCAATGCGAGCAGTTGGAGAAATGTGTAAAGGCCCGGGAGCGGCTAGAGCTCTGTGATGAG
  CGTGTATCCTCTCGATCACATACAGAAGAGGATTGCACGGAGGAGCTCTTTGACTTCTTGCATGCGAGG
  GACCATTGCGTGGCCCACAAACTCTTTAACAACTTGAAATAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001297566
• Insert Size: 249 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001297566.1
• RefSeq Size: 596 bp
• RefSeq ORF: 249 bp
• Locus ID: 7388
• Cytogenetics: 1p33
• Protein Families: Druggable Genome
• Protein Pathways: Alzheimer's disease, Cardiac muscle contraction, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
• MW: 9.6 kDa
• Gene Summary: This is a component of the ubiquinol-cytochrome c reductase complex (complex III or cytochrome b-c1 complex), which is part of the mitochondrial respiratory chain. This protein may mediate formation of the complex between cytochromes c and c1.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) lacks an alternate in-frame exon, compared to variant 1. The encoded isoform (3) is shorter than isoform 1.