SPINK2 (NM_001271721) Human Untagged Clone

CAT#: SC333094

SPINK2 (untagged) - Homo sapiens serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor) (SPINK2), transcript variant 5


  "NM_001271721" in other vectors (2)

Reconstitution Protocol

USD 165.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "SPINK2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SPINK2
Synonyms HUSI-II; SPGF29
Vector pCMV6-Entry
Sequence Data
>SC333094 representing NM_001271721.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGCTGTCGGTGCTGCGCTTGGCGCTGCTGCTCCTGGCAGTTACCTTCGCAGGTAGCGCTCGGAGC
GGTCCTGGCGAGCGGGGACCTCCGGAGAAAAGCGGGTTTGGGAGTCAGACCGGCGGCGGACCCTGCCCT
GCTCCGGGCGGCCTCGGCGACGAACGCCAAACTGCTCTCAGTATAGATTACCAGGATGTCCCAGACACT
TTAACCCTGTGTGTGGCAGTGACATGTCCACTTATGCCAATGAATGTACTCTGTGCATGA

Restriction Sites SgfI-MluI     
ACCN NM_001271721
Insert Size 267 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271721.1
RefSeq Size 701 bp
RefSeq ORF 267 bp
Locus ID 6691
UniProt ID P20155
Cytogenetics 4q12
Protein Families Secreted Protein, Transmembrane
MW 8.9 kDa
Gene Summary This gene encodes a member of the family of serine protease inhibitors of the Kazal type (SPINK). The encoded protein acts as a trypsin and acrosin inhibitor in the genital tract and is localized in the spermatozoa. The protein has been associated with the progression of lymphomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Transcript Variant: This variant (5) uses two alternate splice sites in the 5' coding region which results in a frameshift and an early stop codon, compared to variant 1. It encodes isoform 5 which has a distinct C-terminus and is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.