RTBDN (NM_001270445) Human Untagged Clone

CAT#: SC332937

RTBDN (untagged) - Homo sapiens retbindin (RTBDN), transcript variant 8


  "NM_001270445" in other vectors (2)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
RTBDN Rabbit polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "RTBDN"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RTBDN
Vector pCMV6-Entry
Sequence Data
>SC332937 representing NM_001270445.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGACTGCAGGGTCCACATGCGACCCATCGGCCTGACGTGGGTGCTGCAACTGACCTTGGCATGGATC
CTGCTAGAAGCCTGTGGAGGGAGCCGCCCACTCCAAGCCAGGTCCCAGCAACACCATGGGCTGGCAGCT
GATCTGGGCAAAGGCAAGCTGCACCTGGCAGAGATGGACACAACAGAGACATCGGGCCCTGGAAACCAT
CCAGAACGCTGTGGAGTGCCGAGCCCTGAATGCGAATCCTTCCTGGAACACCTCCAACGTGCCCTTCGC
AGTCGCTTCCGCCTGCGGCTATTGGGGGTACGCCAGGCACAGCCGCTCTGCGAGGAGCTCTGCCAGGCC
TGGTTCGCCAACTGCGAAGATGATATCACCTGCGGCCCGACTTGGCTCCCACTCTCAGAAAAAAGGGGC
TGTGAGCCCAGCTGCCTTACCTATGGACAGACCTTCGCAGACGGGACGGACCTTTGTCGCTCGGCTCTG
GGCCACGCCCTACCGGTGGCTGCTCCTGGAGCCCGTCACTGCTTCAACATCTCCATCTCCGCGGTACCT
CGTCCCAGACCAGGACGACGGGGCCGGGAAGCTCCCTCCCGGCGTTCCCGCAGCCCTCGCACCTCCATC
CTGGACGCTGCGGGCAGCGGGAGTGGCAGTGGAAGCGGCAGCGGCCCCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001270445
Insert Size 672 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270445.1
RefSeq Size 1000 bp
RefSeq ORF 672 bp
Locus ID 83546
UniProt ID Q9BSG5
Cytogenetics 19p13.13
Protein Families Druggable Genome, Secreted Protein
MW 24.1 kDa
Gene Summary This gene was first identified in a study of human eye tissues. The protein encoded by this gene is preferentially expressed in the retina and may play a role in binding retinoids and other carotenoids as it shares homology with riboflavin binding proteins. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (8) differs in the 5' UTR and uses an alternate in-frame splice site in the coding region, compared to variant 1. The encoded isoform (6) is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.