RTBDN (NM_001270441) Human Untagged Clone
CAT#: SC332933
RTBDN (untagged) - Homo sapiens retbindin (RTBDN), transcript variant 4
"NM_001270441" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "RTBDN"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RTBDN |
Vector | pCMV6-Entry |
Sequence Data |
>SC332933 representing NM_001270441.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCCAGGCAGCTCTTATCTCAGGTGGACATGGACTGCAGGGTCCACATGCGACCCATCGGCCTGACG TGGGTGCTGCAACTGACCTTGGCATGGATCCTGCTAGAAGCCTGTGGAGGGAGCCGCCCACTCCAAGCC AGGTCCCAGCAACACCATGGGCTGGCAGCTGATCTGGGCAAAGGCAAGCTGCACCTGGCAGGACCTTGT TGTCCCTCAGAGATGGACACAACAGAGACATCGGGCCCTGGAAACCATCCAGAACGCTGTGGAGTGCCG AGCCCTGAATGCGAATCCTTCCTGGAACACCTCCAACGTGCCCTTCGCAGTCGCTTCCGCCTGCGGCTA TTGGGGGTACGCCAGGCACAGCCGCTCTGCGAGGAGCTCTGCCAGGCCTGGTTCGCCAACTGCGAAGAT GATATCACCTGCGGCCCGACTTGGCTCCCACTCTCAGAAAAAAGGGGCTGTGAGCCCAGCTGCCTTACC TATGGACAGACCTTCGCAGACGGGACGGACCTTTGTCGCTCGGCTCTGGGCCACGCCCTACCGGTGGCT GCTCCTGGAGCCCGTCACTGCTTCAACATCTCCATCTCCGCGGTACCTCGTCCCAGACCAGGACGACGG GGCCGGGAAGCTCCCTCCCGGCGTTCCCGCAGCCCTCGCACCTCCATCCTGGACGCTGCGGGCAGCGGG AGTGGCAGTGGAAGCGGCAGCGGCCCCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270441 |
Insert Size | 720 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001270441.1 |
RefSeq Size | 1042 bp |
RefSeq ORF | 720 bp |
Locus ID | 83546 |
UniProt ID | Q9BSG5 |
Cytogenetics | 19p13.13 |
Protein Families | Druggable Genome, Secreted Protein |
MW | 25.8 kDa |
Gene Summary | This gene was first identified in a study of human eye tissues. The protein encoded by this gene is preferentially expressed in the retina and may play a role in binding retinoids and other carotenoids as it shares homology with riboflavin binding proteins. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants 1, 4, 6 and 7 encode the same isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.