CCDC103 (NM_001258396) Human Untagged Clone

CAT#: SC332690

CCDC103 (untagged) - Homo sapiens coiled-coil domain containing 103 (CCDC103), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CCDC103
• Synonyms: CILD17; PR46b; SMH
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC332690 representing NM_001258396.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGAAAGGAATGACATCATCAACTTCAAGGCTTTGGAGAAAGAGCTGCAGGCTGCACTCACTGCTGAT
  GAGAAGTACAAACGGGAGAATGCTGCCAAGTTACGGGCAGTGGAACAGAGGGTGGCTTCCTATGAGGAG
  TTCAGGGGTATTGTCCTTGCATCACATCTGAAGCCACTGGAGCGGAAGGATAAGATGGGAGGAAAGAGA
  ACTGTGCCCTGGAACTGTCACACTATTCAGGGAAGGACCTTCCAGGATGTGGCCACTGAAATCTCCCCG
  GAGAAAGCCCCCCTCCAGCCCGAGACGTCTGCTGACTTCTATCGTGATTGGCGACGACACTTGCCAAGT
  GGGCCAGAGCGCTACCAGGCTCTACTGCAGCTTGGGGGTCCAAGGCTCGGCTGCCTCTTCCAGACAGAT
  GTGGGATTTGGACTTCTTGGGGAGCTGCTGGTGGCACTGGCTGATCACGTGGGGCCGGCTGACCGGGCA
  GCGGTGCTGGGGATCCTATGCAGCCTGGCGAGCACTGGGCGCTTCACCCTGAACCTAAGCCTGCTGAGC
  CGGGCAGAGAGAGAGAGCTGCAAGGGCTTGTTTCAGAAGCTGCAAGCCATGGGCAACCCCAGATCCGTG
  AAGGAGGGGCTCAGCTGGGAGGAGCAGGGTCTGGAGGAGCAGTCTGGTGGGCTCCAGGAGGAGGAGAGG
  CTCCTGCAGGAGCTGCTGGAGCTGTACCAGGTTGACTGA
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001258396
• Insert Size: 729 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001258396.1
• RefSeq Size: 1750 bp
• RefSeq ORF: 729 bp
• Locus ID: 388389
• UniProt ID: Q8IW40
• Cytogenetics: 17q21.31
• MW: 27.2 kDa
• Gene Summary: This gene encodes a protein that contains a coiled-coil domain. [provided by RefSeq, Apr 2012]
  Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.