GFAP (NM_001242376) Human Untagged Clone

CAT#: SC331793

GFAP (untagged) - Homo sapiens glial fibrillary acidic protein (GFAP), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GFAP
• Synonyms: ALXDRD
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC331793 representing NM_001242376.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGAGAGGAGACGCATCACCTCCGCTGCTCGCCGCTCCTACGTCTCCTCAGGGGAGATGATGGTGGGG
  GGCCTGGCTCCTGGCCGCCGTCTGGGTCCTGGCACCCGCCTCTCCCTGGCTCGAATGCCCCCTCCACTC
  CCGACCCGGGTGGATTTCTCCCTGGCTGGGGCACTCAATGCTGGCTTCAAGGAGACCCGGGCCAGTGAG
  CGGGCAGAGATGATGGAGCTCAATGACCGCTTTGCCAGCTACATCGAGAAGGTTCGCTTCCTGGAACAG
  CAAAACAAGGCGCTGGCTGCTGAGCTGAACCAGCTGCGGGCCAAGGAGCCCACCAAGCTGGCAGACGTC
  TACCAGGCTGAGCTGCGAGAGCTGCGGCTGCGGCTCGATCAACTCACCGCCAACAGCGCCCGGCTGGAG
  GTTGAGAGGGACAATCTGGCACAGGACCTGGCCACTGTGAGGCAGAAGCTCCAGGATGAAACCAACCTG
  AGGCTGGAAGCCGAGAACAACCTGGCTGCCTATAGACAGGAAGCAGATGAAGCCACCCTGGCCCGTCTG
  GATCTGGAGAGGAAGATTGAGTCGCTGGAGGAGGAGATCCGGTTCTTGAGGAAGATCCACGAGGAGGAG
  GTTCGGGAACTCCAGGAGCAGCTGGCCCGACAGCAGGTCCATGTGGAGCTTGACGTGGCCAAGCCAGAC
  CTCACCGCAGCCCTGAAAGAGATCCGCACGCAGTATGAGGCAATGGCGTCCAGCAACATGCATGAAGCC
  GAAGAGTGGTACCGCTCCAAGTTTGCAGACCTGACAGACGCTGCTGCCCGCAACGCGGAGCTGCTCCGC
  CAGGCCAAGCACGAAGCCAACGACTACCGGCGCCAGTTGCAGTCCTTGACCTGCGACCTGGAGTCTCTG
  CGCGGCACGAACGAGTCCCTGGAGAGGCAGATGCGCGAGCAGGAGGAGCGGCACGTGCGGGAGGCGGCC
  AGTTATCAGGAGGCGCTGGCGCGGCTGGAGGAAGAGGGGCAGAGCCTCAAGGACGAGATGGCCCGCCAC
  TTGCAGGAGTACCAGGACCTGCTCAATGTCAAGCTGGCCCTGGACATCGAGATCGCCACCTACAGGAAG
  CTGCTAGAGGGCGAGGAGAACCGGATCACCATTCCCGTGCAGACCTTCTCCAACCTGCAGATTCGAGGT
  CAGTACAGCAGGGCCTCGTGGGAAGGGCACTGGAGTCCTGCCCCCTCCTCCAGGGCCTGTAGGTTGCTC
  CAGACTGGGACTGAGGATCAGGGCAAAGGGATCCAGCTCTCCCTGGGGGCCTTCGTGACACTGCAGCGC
  TCCTAG
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001242376
• Insert Size: 1317 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001242376.1
• RefSeq Size: 2193 bp
• RefSeq ORF: 1317 bp
• Locus ID: 2670
• UniProt ID: P14136
• Cytogenetics: 17q21.31
• Protein Families: ES Cell Differentiation/IPS
• MW: 50.3 kDa
• Gene Summary: This gene encodes one of the major intermediate filament proteins of mature astrocytes. It is used as a marker to distinguish astrocytes from other glial cells during development. Mutations in this gene cause Alexander disease, a rare disorder of astrocytes in the central nervous system. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Oct 2008]
  Transcript Variant: This variant (3) differs at the 3' coding region and 3' UTR, compared to variant 1, which results in a protein (isoform 3, also known as isoform kappa) with a shorter and distinct C-terminus when compared to isoform 1.