ACTG2 (NM_001199893) Human Untagged Clone

CAT#: SC331390

ACTG2 (untagged) - Homo sapiens actin, gamma 2, smooth muscle, enteric (ACTG2), transcript variant 2


  "NM_001199893" in other vectors (2)

Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit polyclonal anti-Actin-gamma2 antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "ACTG2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ACTG2
Synonyms ACT; ACTA3; ACTE; ACTL3; ACTSG; VSCM; VSCM1
Vector pCMV6-Entry
Sequence Data
>SC331390 representing NM_001199893.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTGTGAAGAGGAGACCACCGCGCTCGTGTGTGACAATGGCTCTGGCCTGTGCAAGGCAGGCTTCGCA
GGAGATGATGCCCCCCGGGCTGTCTTCCCCTCCATTGTGGGCCGCCCTCGCCACCAGATCTGGCACCAC
TCCTTCTACAATGAGCTGCGTGTAGCACCTGAAGAGCACCCCACCCTGCTCACAGAGGCTCCCCTAAAT
CCCAAGGCCAACAGGGAAAAGATGACCCAGATCATGTTTGAAACCTTCAATGTCCCTGCCATGTACGTC
GCCATTCAAGCTGTGCTCTCCCTCTATGCCTCTGGCCGCACGACAGGCATCGTCCTGGATTCAGGTGAT
GGCGTCACCCACAATGTCCCCATCTATGAAGGCTATGCCCTGCCCCATGCCATCATGCGCCTGGACTTG
GCTGGCCGTGACCTCACGGACTACCTCATGAAGATCCTCACAGAGAGAGGCTATTCCTTTGTGACCACA
GCTGAGAGAGAAATTGTGCGAGACATCAAGGAGAAGCTGTGCTATGTGGCCCTGGATTTTGAGAATGAG
ATGGCCACAGCAGCTTCCTCTTCCTCCCTGGAGAAGAGCTATGAGCTGCCAGATGGGCAGGTTATCACC
ATTGGCAATGAGCGCTTCCGCTGCCCTGAGACCCTCTTCCAGCCTTCCTTTATTGGCATGGAGTCCGCT
GGAATTCATGAGACAACCTACAATTCCATCATGAAGTGTGACATTGACATCCGTAAGGACTTATATGCC
AACAATGTCCTCTCTGGGGGCACCACCATGTACCCTGGCATTGCTGACAGGATGCAGAAGGAGATCACA
GCCCTGGCCCCCAGCACCATGAAGATCAAGATTATTGCTCCCCCAGAGCGGAAGTACTCAGTCTGGATC
GGGGGCTCTATCCTGGCCTCTCTCTCCACCTTCCAGCAGATGTGGATCAGCAAGCCTGAGTATGATGAG
GCAGGGCCCTCCATTGTCCACAGGAAGTGCTTCTAA

Restriction Sites SgfI-MluI     
ACCN NM_001199893
Insert Size 1002 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199893.1
RefSeq Size 1216 bp
RefSeq ORF 1002 bp
Locus ID 72
UniProt ID P63267
Cytogenetics 2p13.1
Protein Pathways Vascular smooth muscle contraction
MW 37.1 kDa
Gene Summary Actins are highly conserved proteins that are involved in various types of cell motility and in the maintenance of the cytoskeleton. Three types of actins, alpha, beta and gamma, have been identified in vertebrates. Alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. The beta and gamma actins co-exist in most cell types as components of the cytoskeleton and as mediators of internal cell motility. This gene encodes actin gamma 2; a smooth muscle actin found in enteric tissues. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Based on similarity to peptide cleavage of related actins, the mature protein of this gene is formed by removal of two N-terminal peptides.[provided by RefSeq, Dec 2010]
Transcript Variant: This variant (2) lacks an in-frame exon in the 5' coding region, compared to variant 1, that results in a shorter isoform (2), compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.