CALHM6 (NM_001276460) Human Untagged Clone

CAT#: SC331061

FAM26F (untagged) - Homo sapiens family with sequence similarity 26, member F (FAM26F), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CALHM6
• Synonyms: C6orf187; dJ93H18.5; FAM26F; INAM
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC331061 representing NM_001276460.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGTTTCCCGTGTTGGGCTGGATCTTGATAGCAGTTGTTATCATCATTCTTCTGATTTTTACATCTGTC
  ACCCGATGCCTATCTCCAGTTAGTTTTCTGCAGCTGAAATTCTGGAAAATCTATTTGGAACAGGAGCAG
  CAGATCCTTAAAAGTAAAGCCACAGAGCATGCAACTGAATTGGCAAAAGAGAATATTAAATGTTTCTTT
  GAGGGCTCGCATCCAAAAGAATATAACACTCCAAGCATGAAAGAGTGGCAGCAAATTTCATCACTGTAT
  ACTTTCAATCCGAAGGGCCAGTACTACAGCATGTTGCACAAATATGTCAACAGAAAAGAGAAGACTCAC
  AGTATCAGGTCTACTGAAGGAGATACGGTGATTCCTGTTCTTGGCTTTGTAGATTCATCTGGTATAAAC
  AGCACTCCTGAGTTATGA
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001276460
• Insert Size: 432 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001276460.1
• RefSeq Size: 558 bp
• RefSeq ORF: 432 bp
• Locus ID: 441168
• UniProt ID: Q5R3K3
• Cytogenetics: 6q22.1
• Protein Families: Transmembrane
• MW: 16.5 kDa
• Gene Summary: Pore-forming subunit of a voltage-gated ion channel.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) lacks an internal exon, which results in an alternate upstream start codon, compared to variant 1. The resulting isoform (2) is shorter and has a distinct N-terminus, compared to isoform 1.