G protein alpha inhibitor 1 (GNAI1) (NM_001256414) Human Untagged Clone
CAT#: SC330422
GNAI1 (untagged) - Homo sapiens guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 (GNAI1), transcript variant 2
"NM_001256414" in other vectors (2)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | G protein alpha inhibitor 1 |
Synonyms | Gi |
Vector | pCMV6-Entry |
Sequence Data |
>SC330422 representing NM_001256414.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAAAATTATCCATGAAGCTGGTTATTCAGAAGAGGAGTGTAAACAATACAAAGCAGTGGTCTACAGT AACACCATCCAGTCAATTATTGCTATCATTAGGGCTATGGGGAGGTTGAAGATAGACTTTGGTGACTCA GCCCGGGCGGATGATGCACGCCAACTCTTTGTGCTAGCTGGAGCTGCTGAAGAAGGCTTTATGACTGCA GAACTTGCTGGAGTTATAAAGAGATTGTGGAAAGATAGTGGTGTACAAGCCTGTTTCAACAGATCCCGA GAGTACCAGCTTAATGATTCTGCAGCATACTATTTGAATGACTTGGACAGAATAGCTCAACCAAATTAC ATCCCGACTCAACAAGATGTTCTCAGAACTAGAGTGAAAACTACAGGAATTGTTGAAACCCATTTTACT TTCAAAGATCTTCATTTTAAAATGTTTGATGTGGGAGGTCAGAGATCTGAGCGGAAGAAGTGGATTCAT TGCTTCGAAGGAGTGACGGCGATCATCTTCTGTGTAGCACTGAGTGACTACGACCTGGTTCTAGCTGAA GATGAAGAAATGAACCGAATGCATGAAAGCATGAAATTGTTTGACAGCATATGTAACAACAAGTGGTTT ACAGATACATCCATTATACTTTTTCTAAACAAGAAGGATCTCTTTGAAGAAAAAATCAAAAAGAGCCCT CTCACTATATGCTATCCAGAATATGCAGGATCAAACACATATGAAGAGGCAGCTGCATATATTCAATGT CAGTTTGAAGACCTCAATAAAAGAAAGGACACAAAGGAAATATACACCCACTTCACATGTGCCACAGAT ACTAAGAATGTGCAGTTTGTTTTTGATGCTGTAACAGATGTCATCATAAAAAATAATCTAAAAGATTGT GGTCTCTTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001256414 |
Insert Size | 909 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001256414.1 |
RefSeq Size | 3181 bp |
RefSeq ORF | 909 bp |
Locus ID | 2770 |
UniProt ID | P63096 |
Cytogenetics | 7q21.11 |
Protein Families | Druggable Genome |
Protein Pathways | Axon guidance, Chemokine signaling pathway, Gap junction, Leukocyte transendothelial migration, Long-term depression, Melanogenesis, Progesterone-mediated oocyte maturation, Tight junction |
MW | 34.8 kDa |
Gene Summary | Guanine nucleotide binding proteins are heterotrimeric signal-transducing molecules consisting of alpha, beta, and gamma subunits. The alpha subunit binds guanine nucleotide, can hydrolyze GTP, and can interact with other proteins. The protein encoded by this gene represents the alpha subunit of an inhibitory complex. The encoded protein is part of a complex that responds to beta-adrenergic signals by inhibiting adenylate cyclase. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012] Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) is shorter at the N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232421 | GNAI1 (Myc-DDK tagged) - Homo sapiens guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 (GNAI1), transcript variant 2 |
USD 330.00 |
|
RG232421 | GNAI1 (tGFP-tagged) - Homo sapiens guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 (GNAI1), transcript variant 2 |
USD 530.00 |
{0} Product Review(s)
Be the first one to submit a review