COLEC11 (NM_001255983) Human Untagged Clone

CAT#: SC330338

COLEC11 (untagged) - Homo sapiens collectin sub-family member 11 (COLEC11), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: COLEC11
• Synonyms: 3MC2; CL-11; CL-K1-I; CL-K1-II; CL-K1-IIa; CL-K1-IIb; CLK1
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC330338 representing NM_001255983.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGAGGGGGAATCTGGCCCTGGTGGGCGTTCTAATCAGCCTGGCCTTCCTGTCACTGCTGCCATCTGGA
  CATCCTCAGCCGGCTGGCGATGACGCCTGCTCTGTGCAGATCCTCGTCCCTGGCCTCAAAGGGGATGCG
  GGAGAGAAGGGAGACAAAGGCGCCCCCGGACGGCCTGGAAGAGTCGGCCCCACGGGAGAAAAAGGTGAG
  AAAGGAGATTCCGGTGACATAGGACCCCCTGGTCCTAATGGAGAACCAGGCCTCCCATGTGAGTGCAGC
  CAGCTGCGCAAGGCCATCGGGGAGATGGACAACCAGGTCTCTCAGCTGACCAGCGAGCTCAAGTTCATC
  AAGAATGCTGTCGCCGGTGTGCGCGAGACGGAGAGCAAGATCTACCTGCTGGTGAAGGAGGAGAAGCGC
  TACGCGGACGCCCAGCTGTCCTGCCAGGGCCGCGGGGGCACGCTGAGCATGCCCAAGGACGAGGCTGCC
  AATGGCCTGATGGCCGCATACCTGGCGCAAGCCGGCCTGGCCCGTGTCTTCATCGGCATCAACGACCTG
  GAGAAGGAGGGCGCCTTCGTGTACTCTGACCACTCCCCCATGCGGACCTTCAACAAGTGGCGCAGCGGT
  GAGCCCAACAATGCCTACGACGAGGAGGACTGCGTGGAGATGGTGGCCTCGGGCGGCTGGAACGACGTG
  GCCTGCCACACCACCATGTACTTCATGTGTGAGTTTGACAAGGAGAACATGTGA
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001255983
• Insert Size: 744 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001255983.1
• RefSeq Size: 1633 bp
• RefSeq ORF: 744 bp
• Locus ID: 78989
• UniProt ID: Q9BWP8
• Cytogenetics: 2p25.3
• MW: 26.3 kDa
• Gene Summary: This gene encodes a member of the collectin family of C-type lectins that possess collagen-like sequences and carbohydrate recognition domains. Collectins are secreted proteins that play important roles in the innate immune system by binding to carbohydrate antigens on microorganisms, facilitating their recognition and removal. The encoded protein binds to multiple sugars with a preference for fucose and mannose. Mutations in this gene are a cause of 3MC syndrome-2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
  Transcript Variant: This variant (4) lacks an exon in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (d) is shorter than isoform a.