RGS5 (NM_001254748) Human Untagged Clone

CAT#: SC330327

RGS5 (untagged) - Homo sapiens regulator of G-protein signaling 5 (RGS5), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RGS5
• Synonyms: MST092; MST106; MST129; MSTP032; MSTP092; MSTP106; MSTP129
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC330327 representing NM_001254748.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGCTGAGAAGGCAAAGCAAATTTATGAAGAATTCATTCAAACGGAGGCTCCTAAAGAGGTGAATATT
  GACCACTTCACTAAGGACATCACAATGAAGAACCTGGTGGAACCTTCCCTGAGCAGCTTTGACATGGCC
  CAGAAAAGAATCCATGCCCTGATGGAAAAGGATTCTCTGCCTCGCTTTGTGCGCTCTGAGTTTTATCAG
  GAGTTAATCAAGTAG
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001254748
• Insert Size: 222 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001254748.1
• RefSeq Size: 5822 bp
• RefSeq ORF: 222 bp
• Locus ID: 8490
• UniProt ID: O15539
• Cytogenetics: 1q23.3
• Protein Families: Druggable Genome
• MW: 8.7 kDa
• Gene Summary: This gene encodes a member of the regulators of G protein signaling (RGS) family. The RGS proteins are signal transduction molecules which are involved in the regulation of heterotrimeric G proteins by acting as GTPase activators. This gene is a hypoxia-inducible factor-1 dependent, hypoxia-induced gene which is involved in the induction of endothelial apoptosis. This gene is also one of three genes on chromosome 1q contributing to elevated blood pressure. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Dec 2011]
  Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (2, also known as RGS5s), which is localized almost exclusively to the cytosolic fraction, is shorter at the N-terminus, compared to isoform 1. Both variants 2 and 3 encode isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.