NUDT9 (NM_001248011) Human Untagged Clone

CAT#: SC330242

NUDT9 (untagged) - Homo sapiens nudix (nucleoside diphosphate linked moiety X)-type motif 9 (NUDT9), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NUDT9
• Synonyms: NUDT10
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC330242 representing NM_001248011.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGCGGGACGCCTCCTGGGAAAGGCTTTAGCCGCGGTGTCTCTCTCTCTGGCCTTGGCCTCTGTGACT
  ATCAGGTCCTCGCGCTGCCGCGGCATCCAGGCGTTCAGAAACTCGTTTTCATCTTCTTGGTTTCATCTT
  AATACCAACGTCATGTCTGGTTCTAATGGTTCCAAAGAAAATTCTCACAATAAGGCTCGGACGTCTCCT
  TACCCAGGTTCAAAAGTTGAACGAAGCCAGGTTCCTAATGAGAAAGTGGGCTGGCTTGTTGAGTGGCAA
  GACTATAAGCCTGTGGAATACACTGCAGTCTCTGTCTTGGCTGGACCCAGGTGGGCAGATCCTCAGATC
  AGAAATCCTGCAGGACGGACTGGACTGGTGGGCCGGGGGCTTTTGGGGCGATGGGGCCCAAATCACGCT
  GCAGATCCCATTATAACCAGATGGAAAAGGGATAGCAGTGGAAATAAAATCATGCATCCTGTTTCTGGG
  AAGCATATCTTACAATTTGTTGCAATAAAAAGGAAAGACTGTGGAGAATGGGCAATCCCAGGGGGGATG
  GTGGATCCAGGAGAGAAGATTAGTGCCACACTGAAAAGAGAATTTGGTGAGGAAGCTCTCAACTCCTTA
  CAGAAAACCAGTGCTGAGAAGAGAGAAATAGAGGAAAAGTTGCACAAACTCTTCAGCCAAGACCACCTA
  GTGATATATAAGGGATATGTTGATGATCCTCGAAACACTGATAATGCATGGATGGAGACAGAAGCTGTG
  AACTACCATGACGAAACAGGTGAGATAATGGATAATCTTATGCTAGAAGCTGGAGATGATGCTGGAAAA
  GTGAAATGGGTGGACATCAATGATAAACTGAAGCTTTATGCCAGTCACTCTCAATTCATCAAACTTGTG
  GCTGAGAAACGAGATGCACACTGGAGCGAGGACTCTGAAGCTGACTGCCATGCGTTGTAG
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001248011
• Insert Size: 957 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001248011.1
• RefSeq Size: 2720 bp
• RefSeq ORF: 957 bp
• Locus ID: 53343
• UniProt ID: Q9BW91
• Cytogenetics: 4q22.1
• Protein Families: Druggable Genome, Ion Channels: Other
• Protein Pathways: Purine metabolism
• MW: 35.4 kDa
• Gene Summary: The protein encoded by this gene belongs to the Nudix hydrolase family. Nudix boxes are found in a family of diverse enzymes that catalyze the hydrolysis of nucleoside diphosphate derivatives. This enzyme is an ADP-ribose pyrophosphatase that catalyzes the hydrolysis of ADP-ribose to AMP and ribose-5-P. It requires divalent metal ions and an intact Nudix motif for enzymatic activity. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
  Transcript Variant: This variant (3) lacks an in-frame coding exon compared to variant 1. This results in a shorter isoform (c) missing an internal protein segment compared to isoform a.