PAMM (FAM213A) (NM_001243780) Human Untagged Clone

CAT#: SC330184

FAM213A (untagged) - Homo sapiens family with sequence similarity 213, member A (FAM213A), transcript variant 4


  "NM_001243780" in other vectors (2)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


PRXL2A rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "PAMM"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PAMM
Synonyms Adrx; C10orf58; FAM213A; PAMM
Vector pCMV6-Entry
Sequence Data
>SC330184 representing NM_001243780.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCTTTCCTCCAGGACCCAAGTTTCTTCACCATGGGGATGTGGTCCATTGGTGCAGGAGCCCTGGGG
GCTGCTGCCTTGGCATTGCTGCTTGCCAACACAGACGTGTTTCTGTCCAAGCCCCAGAAAGCGGCCCTG
GAGTACCTGGAGGATATAGACCTGAAAACACTGGAGAAGGAACCAAGGACTTTCAAAGCAAAGGAGCTA
TGGGAAAAAAATGGAGCTGTGATTATGGCCGTGCGGAGGCCAGGCTGTTTCCTCTGTCGAGAGGAAGCT
GCGGATCTGTCCTCCCTGAAAAGCATGTTGGACCAGCTGGGCGTCCCCCTCTATGCAGTGGTAAAGGAG
CACATCAGGACTGAAGTGAAGGATTTCCAGCCTTATTTCAAAGGAGAAATCTTCCTGGATGAAAAGAAA
AAGTTCTATGGTCCACAAAGGCGGAAGATGATGTTTATGGGATTTATCCGTCTGGGAGTGTGGTACAAC
TTCTTCCGAGCCTGGAACGGAGGCTTCTCTGGAAACCTGGAAGGAGAAGGCTTCATCCTTGGGGGAGTT
TTCGTGGTGGGATCAGGAAAGCAGGGCATTCTTCTTGAGCACCGAGAAAAAGAATTTGGAGACAAAGTA
AACCTACTTTCTGTTCTGGAAGCTGCTAAGATGATCAAACCACAGACTTTGGCCTCAGAGAAAAAATGA

Restriction Sites SgfI-MluI     
ACCN NM_001243780
Insert Size 690 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243780.1
RefSeq Size 2239 bp
RefSeq ORF 690 bp
Locus ID 84293
UniProt ID Q9BRX8
Cytogenetics 10q23.1
Protein Families Secreted Protein, Transmembrane
MW 25.8 kDa
Gene Summary Involved in redox regulation of the cell (PubMed:26438880, PubMed:19951071). Acts as an antioxidant (PubMed:19951071, PubMed:26438880). Inhibits TNFSF11-induced NFKB1 and JUN activation and osteoclast differentiation (PubMed:19951071). May affect bone resorption and help to maintain bone mass (PubMed:19951071). Acts as a negative regulator of macrophage-mediated inflammation by inhibiting macrophage production of inflammatory cytokines, probably through suppression of the MAPK signaling pathway (PubMed:26438880).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) uses an alternate splice site in the 5' UTR compared to variant 1. Variants 1, 2, 3 and 4 encode the same isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.