EFHD1 (NM_001243252) Human Untagged Clone

CAT#: SC330108

EFHD1 (untagged) - Homo sapiens EF-hand domain family, member D1 (EFHD1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: EFHD1
• Synonyms: MST133; MSTP133; PP3051; SWS2
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC330108 representing NM_001243252.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGGAGAGTTGCAGTATGACGCTGGGCGGGATGGCTTCATCGACCTGATGGAGCTGAAGCTGATGATG
  GAGAAGCTGGGGGCCCCCCAGACCCACCTGGGCCTGAAGAGCATGATCAAGGAGGTGGATGAGGACTTC
  GATGGCAAGCTCAGCTTCCGGGAGTTCCTGCTCATTTTCCACAAGGCCGCGGCAGGGGAGCTGCAGGAG
  GACAGTGGGCTGATGGCGCTGGCAAAGCTTTCTGAGATCGATGTGGCCCTGGAGGGTGTCAAAGGTGCC
  AAGAACTTCTTTGAAGCCAAGGTCCAAGCCTTGTCATCGGCCAGTAAGTTTGAAGCAGAGTTGAAAGCT
  GAGCAAGATGAGCGGAAGCGGGAGGAGGAGGAGAGGCGGCTCCGCCAGGCAGCCTTCCAGAAACTCAAG
  GCCAACTTCAATACATAG
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001243252
• Insert Size: 432 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001243252.1
• RefSeq Size: 1607 bp
• RefSeq ORF: 432 bp
• Locus ID: 80303
• UniProt ID: Q9BUP0
• Cytogenetics: 2q37.1
• MW: 16.1 kDa
• Gene Summary: This gene encodes a member of the EF-hand super family of calcium binding proteins, which are involved in a variety of cellular processes including mitosis, synaptic transmission, and cytoskeletal rearrangement. The protein encoded by this gene is composed of an N-terminal disordered region, proline-rich elements, two EF-hands, and a C-terminal coiled-coil domain. This protein has been shown to associate with the mitochondrial inner membrane, and in HeLa cells, acts as a novel mitochondrial calcium ion sensor for mitochondrial flash activation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
  Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region and uses an alternate start codon, compared to variant 1. The encoded isoform (2) is shorter and has a distinct N-terminus, compared to isoform 1.