Bif (SH3GLB1) (NM_001206653) Human Untagged Clone
CAT#: SC329826
SH3GLB1 (untagged) - Homo sapiens SH3-domain GRB2-like endophilin B1 (SH3GLB1), transcript variant 4
"NM_001206653" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "Bif"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | Bif |
Synonyms | Bif-1; CGI-61; dJ612B15.2; PPP1R70 |
Vector | pCMV6-Entry |
Sequence Data |
>SC329826 representing NM_001206653.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGATTGATGCAGGGACTGAGTTTGGCCCAGGAACAGCTTATGGTAATGCCCTTATTAAATGTGGAGAA ACCCAAAAAAGAATTGGAACAGCAGACAGAGAACTGATTCAAACGTCAGCCTTAAATTTTCTTACTCCT TTAAGAAACTTTATAGAAGGAGATTACAAAACAATTGCTAAAGAAAGGAAACTATTGCAAAATAAGAGA CTGGATTTGGATGCTGCAAAAACGAGACTAAAAAAGGCAAAAGCTGCAGAAACTAGAAATTCATCTGAA CAGGAATTAAGAATAACTCAAAGTGAATTTGATCGTCAAGCAGAGATTACCAGACTTCTGCTAGAGGGA ATCAGCAGTACACATGCCCATCACCTTCGCTGTCTGAATGACTTTGTAGAAGCCCAGATGACTTACTAT GCACAGTGTTACCAGTATATGTTGGACCTCCAGAAACAACTGGGAAGTTTTCCATCCAATTATCTTAGT AACAACAATCAGACTTCTGTGACACCTGTACCATCAGTTTTACCAAATGCGATTGGTTCTTCTGCCATG GCTTCAACAAGTGGCCTAGTAATCACCTCTCCTTCCAACCTCAGTGACCTTAAGGAGTGTAGTGGCAGC AGAAAGGCCAGGGTTCTCTATGATTATGATGCAGCAAACAGTACTGAATTATCACTTCTGGCAGATGAG GTGATCACTGTGTTCAGTGTTGTTGGAATGGATTCAGACTGGCTAATGGGGGAAAGGGGAAACCAGAAG GGCAAGGTGCCAATTACCTACTTAGAACTGCTCAATTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001206653 |
Insert Size | 798 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001206653.1 |
RefSeq Size | 6240 bp |
RefSeq ORF | 798 bp |
Locus ID | 51100 |
UniProt ID | Q9Y371 |
Cytogenetics | 1p22.3 |
Protein Pathways | Endocytosis |
MW | 29.3 kDa |
Gene Summary | This gene encodes a SRC homology 3 domain-containing protein. The encoded protein interacts with the proapoptotic member of the Bcl-2 family, Bcl-2-associated X protein (Bax) and may be involved in regulating apoptotic signaling pathways. This protein may also be involved in maintaining mitochondrial morphology. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011] Transcript Variant: This variant (4) lacks an exon in the 5' region, resulting in a downstream AUG start codon, compared to variant 1. The resulting isoform (4) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.