SRP19 (NM_001204193) Human Untagged Clone
CAT#: SC329723
SRP19 (untagged) - Homo sapiens signal recognition particle 19kDa (SRP19), transcript variant 2
"NM_001204193" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "SRP19"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SRP19 |
Vector | pCMV6-Entry |
Sequence Data |
>SC329723 representing NM_001204193.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCTTGCGCTGCCGCGCGGTCCCCGGCCGACCAGGACAGGTTTATTTGTATCTATCCTGCTTATTTA AATAATAAGAAGACCATCGCAGAGGGAAGGCGAATCCCCATAAGTAAGGCTGTTGAAAATCCTACAGCT ACAGAGATTCAAGATGTATGTTCAGCAGTTGGACTTAACGTATTTCTTGAGAAAAATAAAATGTACTCT AGAGAATGGAATCGTGATGTCCAATACAGAGGCAGAGTCCGGGTCCAGCTCAAACAGGAAGATGGGAGC CTCTGCCTTGTACAGTTCCCATCACATTATACACTAAGCCTAACTTCTGGTTCCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001204193 |
Insert Size | 333 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001204193.1 |
RefSeq Size | 1534 bp |
RefSeq ORF | 333 bp |
Locus ID | 6728 |
UniProt ID | P09132 |
Cytogenetics | 5q22.2 |
Protein Pathways | Protein export |
MW | 12.4 kDa |
Gene Summary | Signal-recognition-particle assembly, binds directly to 7S RNA and mediates binding of the 54 kDa subunit of the SRP.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate splice site that results in a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (2) has a distinct and shorter C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.