RPL17 (NM_001199345) Human Untagged Clone

CAT#: SC329519

RPL17 (untagged) - Homo sapiens ribosomal protein L17 (RPL17), transcript variant 8

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RPL17
• Synonyms: L17; PD-1; RPL23
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC329519 representing NM_001199345.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGCATATACGAAAAGCCACGAAGTATCTGAAAGATGTCACTTTACAGAAACAGTGTGTACCATTCCGA
  CGTTACAATGGTGGAGTTGGCAGGTGTGCGCAGGCCAAGCAATGGGGCTGGACACAAGGTCGGTGGCCC
  AAAAAGAGTGCTGAATTTTTGCTGCACATGCTTAAAAACGCAGAGAGTAATGCTGAACTTAAGGGTTTA
  GATGTAGATTCTCTGGTCATTGAGCATATCCAAGTGAACAAAGCACCTAAGATGCGCCGCCGGACCTAC
  AGAGCTCATGGTCGGATTAACCCATACATGAGCTCTCCCTGCCACATTGAGATGATCCTTACGGAAAAG
  GAACAGATTGTTCCTAAACCAGAAGAGGAGGTTGCCCAGAAGAAAAAGATATCCCAGAAGAAACTGAAG
  AAACAAAAACTTATGGCACGGGAGTAA
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199345
• Insert Size: 441 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001199345.1
• RefSeq Size: 695 bp
• RefSeq ORF: 441 bp
• Locus ID: 6139
• UniProt ID: P18621
• Cytogenetics: 18q21.1
• Protein Pathways: Ribosome
• MW: 17.1 kDa
• Gene Summary: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L22P family of ribosomal proteins. It is located in the cytoplasm. This gene has been referred to as rpL23 because the encoded protein shares amino acid identity with ribosomal protein L23 from Halobacterium marismortui; however, its official symbol is RPL17. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream C18orf32 (chromosome 18 open reading frame 32) gene. [provided by RefSeq, Dec 2010]
  Transcript Variant: This variant (8) differs in the 5' UTR, lacks an exon in the 5' coding region, and uses a downstream start codon, compared to variant 1. The encoded isoform (b) is shorter at the N-terminus, compared to isoform a.