EGF (NM_001178131) Human Untagged Clone

CAT#: SC329304

Reviews ()
Write a review

EGF (untagged)-Human epidermal growth factor (EGF) transcript variant 3

  View "NM_001178131" in other vectors (6)

USD 2,360.00


Availability*
6 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name EGF (NM_001178131) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol EGF
Synonyms HOMG4; URG
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001178131, the custom clone sequence may differ by one or more nucleotides
ATGCTGCTCACTCTTATCATTCTGTTGCCAGTAGTTTCAAAATTTAGTTTTGTTAGTCTC
TCAGCACCGCAGCACTGGAGCTGTCCTGAAGGTACTCTCGCAGGAAATGGGAATTCTACT
TGTGTGGGTCCTGCACCCTTCTTAATTTTCTCCCATGGAAATAGTATCTTTAGGATTGAC
ACAGAAGGAACCAATTATGAGCAATTGGTGGTGGATGCTGGTGTCTCAGTGATCATGGAT
TTTCATTATAATGAGAAAAGAATCTATTGGGTGGATTTAGAAAGACAACTTTTGCAAAGA
GTTTTTCTGAATGGGTCAAGGCAAGAGAGAGTATGTAATATAGAGAAAAATGTTTCTGGA
ATGGCAATAAATTGGATAAATGAAGAAGTTATTTGGTCAAATCAACAGGAAGGAATCATT
ACAGTAACAGATATGAAAGGAAATAATTCCCACATTCTTTTAAGTGCTTTAAAATATCCT
GCAAATGTAGCAGTTGATCCAGTAGAAAGGTTTATATTTTGGTCTTCAGAGGTGGCTGGA
AGCCTTTATAGAGCAGATCTCGATGGTGTGGGAGTGAAGGCTCTGTTGGAGACATCAGAG
AAAATAACAGCTGTGTCATTGGATGTGCTTGATAAGCGGCTGTTTTGGATTCAGTACAAC
AGAGAAGGAAGCAATTCTCTTATTTGCTCCTGTGATTATGATGGAGGTTCTGTCCACATT
AGTAAACATCCAACACAGCATAATTTGTTTGCAATGTCCCTTTTTGGTGACCGTATCTTC
TATTCAACATGGAAAATGAAGACAATTTGGATAGCCAACAAACACACTGGAAAGGACATG
GTTAGAATTAACCTCCATTCATCATTTGTACCACTTGGTGAACTGAAAGTAGTGCATCCA
CTTGCACAACCCAAGGCAGAAGATGACACTTGGGAGCCTGATGTTAATGAATGTGCTTTT
TGGAATCATGGCTGTACTCTTGGGTGTAAAAACACCCCTGGATCCTATTACTGCACGTGC
CCTGTAGGATTTGTTCTGCTTCCTGATGGGAAACGATGTCATCAACTTGTTTCCTGTCCA
CGCAATGTGTCTGAATGCAGCCATGACTGTGTTCTGACATCAGAAGGTCCCTTATGTTTC
TGTCCTGAAGGCTCAGTGCTTGAGAGAGATGGGAAAACATGTAGCGGTTGTTCCTCACCC
GATAATGGTGGATGTAGCCAGCTCTGCGTTCCTCTTAGCCCAGTATCCTGGGAATGTGAT
TGCTTTCCTGGGTATGACCTACAACTGGATGAAAAAAGCTGTGCAGCTTCAGGACCACAA
CCATTTTTGCTGTTTGCCAATTCTCAAGATATTCGACACATGCATTTTGATGGAACAGAC
TATGGAACTCTGCTCAGCCAGCAGATGGGAATGGTTTATGCCCTAGATCATGACCCTGTG
GAAAATAAGATATACTTTGCCCATACAGCCCTGAAGTGGATAGAGAGAGCTAATATGGAT
GGTTCCCAGCGAGAAAGGCTTATTGAGGAAGGAGTAGATGTGCCAGAAGGTCTTGCTGTG
GACTGGATTGGCCGTAGATTCTATTGGACAGACAGAGGGAAATCTCTGATTGGAAGGAGT
GATTTAAATGGGAAACGTTCCAAAATAATCACTAAGGAGAACATCTCTCAACCACGAGGA
ATTGCTGTTCATCCAATGGCCAAGAGATTATTCTGGACTGATACAGGGATTAATCCACGA
ATTGAAAGTTCTTCCCTCCAAGGCCTTGGCCGTCTGGTTATAGCCAGCTCTGATCTAATC
TGGCCCAGTGGAATAACGATTGACTTCTTAACTGACAAGTTGTACTGGTGCGATGCCAAG
CAGTCTGTGATTGAAATGGCCAATCTGGATGGTTCAAAACGCCGAAGACTTACCCAGAAT
GATGTAGGTCACCCATTTGCTGTAGCAGTGTTTGAGGATTATGTGTGGTTCTCAGATTGG
GCTATGCCATCAGTAATGAGAGTAAACAAGAGGACTGGCAAAGATAGAGTACGTCTCCAA
GGCAGCATGCTGAAGCCCTCATCACTGGTTGTGGTTCATCCATTGGCAAAACCAGGAGCA
GATCCCTGCTTATATCAAAACGGAGGCTGTGAACATATTTGCAAAAAGAGGCTTGGAACT
GCTTGGTGTTCGTGTCGTGAAGGTTTTATGAAAGCCTCAGATGGGAAAACGTGTCTGGCT
CTGGATGGTCATCAGCTGTTGGCAGGTGGTGAAGTTGATCTAAAGAACCAAGTAACACCA
TTGGACATCTTGTCCAAGACTAGAGTGTCAGAAGATAACATTACAGAATCTCAACACATG
CTAGTGGCTGAAATCATGGTGTCAGATCAAGATGACTGTGCTCCTGTGGGATGCAGCATG
TATGCTCGGTGTATTTCAGAGGGAGAGGATGCCACATGTCAGTGTTTGAAAGGATTTGCT
GGGGATGGAAAACTATGTTCTGATATAGATGAATGTGAGATGGGTGTCCCAGTGTGCCCC
CCTGCCTCCTCCAAGTGCATCAACACCGAAGGTGGTTATGTCTGCCGGTGCTCAGAAGGC
TACCAAGGAGATGGGATTCACTGTCTTGATATTGATGAGTGCCAACTGGGGGAGCACAGC
TGTGGAGAGAATGCCAGCTGCACAAATACAGAGGGAGGCTATACCTGCATGTGTGCTGGA
CGCCTGTCTGAACCAGGACTGATTTGCCCTGACTCTACTCCACCCCCTCACCTCAGGGAA
GATGACCACCACTATTCCGTAAGAAATAGTGACTCTGAATGTCCCCTGTCCCACGATGGG
TACTGCCTCCATGATGGTGTGTGCATGTATATTGAAGCATTGGACAAGTATGCATGCAAC
TGTGTTGTTGGCTACATCGGGGAGCGATGTCAGTACCGAGACCTGAAGTGGTGGGAACTG
CGCCACGCTGGCCACGGGCAGCAGCAGAAGGTCATCGTGGTGGCTGTCTGCGTGGTGGTG
CTTGTCATGCTGCTCCTCCTGAGCCTGTGGGGGGCCCACTACTACAGGACTCAGAAGCTG
CTATCGAAAAACCCAAAGAATCCTTATGAGGAGTCGAGCAGAGATGTGAGGAGTCGCAGG
CCTGCTGACACTGAGGATGGGATGTCCTCTTGCCCTCAACCTTGGTTTGTGGTTATAAAA
GAACACCAAGACCTCAAGAATGGGGGTCAACCAGTGGCTGGTGAGGATGGCCAGGCAGCA
GATGGGTCAATGCAACCAACTTCATGGAGGCAGGAGCCCCAGTTATGTGGAATGGGCACA
GAGCAAGGCTGCTGGATTCCAGTATCCAGTGATAAGGGCTCCTGTCCCCAGGTAATGGAG
CGAAGCTTTCATATGCCCTCCTATGGGACACAGACCCTTGAAGGGGGTGTCGAGAAGCCC
CATTCTCTCCTATCAGCTAACCCATTATGGCAACAAAGGGCCCTGGACCCACCACACCAA
ATGGAGCTGACTCAGTGA
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_001178131
ORF Size 3498 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001178131.1, NP_001171602.1
RefSeq Size 5474
RefSeq ORF 3498
Locus ID 1950
Cytogenetics 4q25
Protein Families Adult stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Induced pluripotent stem cells, Transmembrane
Protein Pathways Bladder cancer, Cytokine-cytokine receptor interaction, Endocytosis, Endometrial cancer, ErbB signaling pathway, Focal adhesion, Gap junction, Glioma, MAPK signaling pathway, Melanoma, Non-small cell lung cancer, Pancreatic cancer, Pathways in cancer, Prostate cancer, Regulation of actin cytoskeleton
Gene Summary This gene encodes a member of the epidermal growth factor superfamily. The encoded preproprotein is proteolytically processed to generate the 53-amino acid epidermal growth factor peptide. This protein acts a potent mitogenic factor that plays an important role in the growth, proliferation and differentiation of numerous cell types. This protein acts by binding with high affinity to the cell surface receptor, epidermal growth factor receptor. Defects in this gene are the cause of hypomagnesemia type 4. Dysregulation of this gene has been associated with the growth and progression of certain cancers. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]
Transcript Variant: This variant (3) lacks an in-frame exon in the coding region, compared to variant 1. The encoded isoform (3) is shorter than isoform 1. This isoform (3) may undergo proteolytic processing similar to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

Frequently bought together (2)
EGF mouse monoclonal antibody,clone OTI2F9
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones