Iduronate 2 sulfatase (IDS) (NM_001166550) Human Untagged Clone

CAT#: SC328761

IDS (untagged)-Human iduronate 2-sulfatase (IDS) transcript variant 3


  "NM_001166550" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
IDS (Iduronate 2 sulfatase) mouse monoclonal antibody, clone OTI4G2 (formerly 4G2)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Iduronate 2 sulfatase"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Iduronate 2 sulfatase
Synonyms ID2S; MPS2; SIDS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328761 representing NM_001166550.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCTTTGCGCAGGAGACCTGACACCACCCGCCTGTACGACTTCAACTCCTACTGGAGGGTGCACGCT
GGAAACTTCTCCACCATCCCCCAGTACTTCAAGGAGAATGGCTATGTGACCATGTCGGTGGGAAAAGTC
TTTCACCCTGGGATATCTTCTAACCATACCGATGATTCTCCGTATAGCTGGTCTTTTCCACCTTATCAT
CCTTCCTCTGAGAAGTATGAAAACACTAAGACATGTCGAGGGCCAGATGGAGAACTCCATGCCAACCTG
CTTTGCCCTGTGGATGTGCTGGATGTTCCCGAGGGCACCTTGCCTGACAAACAGAGCACTGAGCAAGCC
ATACAGTTGTTGGAAAAGATGAAAACGTCAGCCAGTCCTTTCTTCCTGGCCGTTGGGTATCATAAGCCA
CACATCCCCTTCAGATACCCCAAGGAATTTCAGAAGTTGTATCCCTTGGAGAACATCACCCTGGCCCCC
GATCCCGAGGTCCCTGATGGCCTACCCCCTGTGGCCTACAACCCCTGGATGGACATCAGGCAACGGGAA
GACGTCCAAGCCTTAAACATCAGTGTGCCGTATGGTCCAATTCCTGTGGACTTTCAGCGGAAAATCCGC
CAGAGCTACTTTGCCTCTGTGTCATATTTGGATACACAGGTCGGCCGCCTCTTGAGTGCTTTGGACGAT
CTTCAGCTGGCCAACAGCACCATCATTGCATTTACCTCGGATCATGGGTGGGCTCTAGGTGAACATGGA
GAATGGGCCAAATACAGCAATTTTGATGTTGCTACCCATGTTCCCCTGATATTCTATGTTCCTGGAAGG
ACGGCTTCACTTCCGGAGGCAGGCGAGAAGCTTTTCCCTTACCTCGACCCTTTTGATTCCGCCTCACAG
TTGATGGAGCCAGGCAGGCAATCCATGGACCTTGTGGAACTTGTGTCTCTTTTTCCCACGCTGGCTGGA
CTTGCAGGACTGCAGGTTCCACCTCGCTGCCCCGTTCCTTCATTTCACGTTGAGCTGTGCAGAGAAGGC
AAGAACCTTCTGAAGCATTTTCGATTCCGTGACTTGGAAGAGGATCCGTACCTCCCTGGTAATCCCCGT
GAACTGATTGCCTATAGCCAGTATCCCCGGCCTTCAGACATCCCTCAGTGGAATTCTGACAAGCCGAGT
TTAAAAGATATAAAGATCATGGGCTATTCCATACGCACCATAGACTATAGGTATACTGTGTGGGTTGGC
TTCAATCCTGATGAATTTCTAGCTAACTTTTCTGACATCCATGCAGGGGAACTGTATTTTGTGGATTCT
GACCCATTGCAGGATCACAATATGTATAATGATTCCCAAGGTGGAGATCTTTTCCAGTTGTTGATGCCT
TGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001166550
Insert Size 1383 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001166550.3
RefSeq Size 7595 bp
RefSeq ORF 1383 bp
Locus ID 3423
UniProt ID P22304
Cytogenetics Xq28
Protein Families Druggable Genome
Protein Pathways Glycosaminoglycan degradation, Lysosome, Metabolic pathways
MW 52.4 kDa
Gene Summary This gene encodes a member of the sulfatase family of proteins. The encoded preproprotein is proteolytically processed to generate two polypeptide chains. This enzyme is involved in the lysosomal degradation of heparan sulfate and dermatan sulfate. Mutations in this gene are associated with the X-linked lysosomal storage disease mucopolysaccharidosis type II, also known as Hunter syndrome. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]
Transcript Variant: This variant (3) uses an alternate acceptor splice site in the 5' coding region, which results in translation initiation from a downstream initiation codon compared to variant 1. The encoded isoform (c) has a shorter and distinct N-terminus, and lacks a predicted signal peptide compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.