LY108 (SLAMF6) (NM_001184714) Human Untagged Clone

CAT#: SC328537

SLAMF6 (untagged)-Human SLAM family member 6 (SLAMF6) transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LY108
• Synonyms: CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_001184714 edited
  ATGTTGTGGCTGTTCCAATCGCTCCTGTTTGTCTTCTGCTTTGGCCCAGGGAATGTAGTT
  TCACAAAGCAGCTTAACCCCATTGATGGTGAACGGGATTCTGGGGGAGTCAGTAACTCTT
  CCCCTGGAGTTTCCTGCAGGAGAGAAGGTCAACTTCATCACTTGGCTTTTCAATGAAACA
  TCTCTTGCCTTCATAGTACCCCATGAAACCAAAAGTCCAGAAATCCACGTGACTAATCCG
  AAACAGGGAAAGCGACTGAACTTCACCCAGTCCTACTCCCTGCAACTCAGCAACCTGAAG
  ATGGAAGACACAGGCTCTTACAGAGCCCAGATATCCACAAAGACCTCTGCAAAGCTGTCC
  AGTTACACTCTGAGGATATTAAGACAACTGAGGAACATACAAGTTACCAATCACAGTCAG
  CTATTTCAGAATATGACCTGTGAGCTCCATCTGACTTGCTCTGTGGAGGATGCAGATGAC
  AATGTCTCATTCAGATGGGAGGCCTTGGGAAACACACTTTCAAGTCAGCCAAACCTCACT
  GTCTCCTGGGACCCCAGGATTTCCAGTGAACAGGACTACACCTGCATAGCAGAGAATGCT
  GTCAGTAATTTATCCTTCTCTGTCTCTGCCCAGAAGCTTTGCGAAGATGTTAAAATTCAA
  TATACAGATACCAAAATGATTCTGTTTATGGTTTCTGGGATATGCATAGTCTTCGGTTTC
  ATCATACTGCTGTTACTTGTTTTGAGGAAAAGAAGAGATTCCCTATCTTTGTCTACTCAG
  CGAACACAGGGCCCCGCAGAGTCCGCAAGGAACCTAGAGTATGTTTCAGTGTCTCCAACG
  AACAACACTGTGTATGCTTCAGTCACTCATTCAAACAGGGAAACAGAAATCTGGACACCT
  AGAGAAAATGATACTATCACAATTTACTCCACAATTAATCATTCCAAAGAGAGTAAACCC
  ACTTTTTCCAGGGCAACTGCCCTTGACAATGTCGTGTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_001184714
• Insert Size: 2800 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001184714.1, NP_001171643.1
• RefSeq Size: 2754 bp
• RefSeq ORF: 999 bp
• Locus ID: 114836
• UniProt ID: Q96DU3
• Cytogenetics: 1q23.2-q23.3
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: The protein encoded by this gene is a type I transmembrane protein, belonging to the CD2 subfamily of the immunoglobulin superfamily. This encoded protein is expressed on Natural killer (NK), T, and B lymphocytes. It undergoes tyrosine phosphorylation and associates with the Src homology 2 domain-containing protein (SH2D1A) as well as with SH2 domain-containing phosphatases (SHPs). It functions as a coreceptor in the process of NK cell activation. It can also mediate inhibitory signals in NK cells from X-linked lymphoproliferative patients. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).