AMHR2 (NM_001164690) Human Untagged Clone
CAT#: SC327559
AMHR2 (untagged)-Human anti-Mullerian hormone receptor type II (AMHR2) transcript variant 2
"NM_001164690" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | AMHR2 |
Synonyms | AMHR; MISR2; MISRII; MRII |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001164690, the custom clone sequence may differ by one or more nucleotides
ATGCTAGGGTCTTTGGGGCTTTGGGCATTACTTCCCACAGCTGTGGAAGCACCCCCAAAC AGGCGAACCTGTGTGTTCTTTGAGGCCCCTGGAGTGCGGGGAAGCACAAAGACACTGGGA GAGCTGCTAGATACAGGCACAGAGCTCCCCAGAGCTATCCGCTGCCTCTACAGCCGCTGC TGCTTTGGGATCTGGAACCTGACCCAAGACCGGGCACAGGTGGAAATGCAAGGATGCCGA GACAGTGATGAGCCAGGCTGTGAGTCCCTCCACTGTGACCCAAGTCCCCGAGCCCACCCC AGCCCTGGCTCCACTCTCTTCACCTGCTCCTGTGGCACTGACTTCTGCAATGCCAATTAC AGCCATCTGCCTCCTCCAGGGAGCCCTGGGACTCCTGGCTCCCAGGGTCCCCAGGCTGCC CCAGGTGAGTCCATCTGGATGGCACTGGTGCTGCTGGGGCTGTTCCTCCTCCTCCTGCTG CTGCTGGGCAGCATCATCTTGGCCCTGCTACAGCGAAAGAACTACAGAGTGCGAGGTGAG CCAGTGCCAGAGCCAAGGCCAGACTCAGGCAGGGACTGGAGTGTGGAGCTGCAGGAGCTG CCTGAGCTGTGTTTCTCCCAGGTAATCCGGGAAGGAGGTCATGCAGTGGTTTGGGCCGGG CAGCTGCAAGGAAAACTGGTTGCCATCAAGGCCTTCCCACCGAGGTCTGTGGCTCAGTTC CAAGCTGAGAGAGCATTGTACGAACTTCCAGGCCTACAGCACGACCACATTGTCCGATTT ATCACTGCCAGCCGGGGGGGTCCTGGCCGCCTGCTCTCTGGGCCCCTGCTGGTACTGGAA CTGCATCCCAAGGGCTCCCTGTGCCACTACTTGACCCAGTACACCAGTGACTGGGGAAGT TCCCTGCGGATGGCACTGTCCCTGGCCCAGGGCCTGGCATTTCTCCATGAGGAGCGCTGG CAGAATGGCCAATATAAACCAGGTATTGCCCACCGAGATCTGAGCAGCCAGAATGTGCTC ATTCGGGAAGATGGATCGTGTGCCATTGGAGACCTGGGCCTTGCCTTGGTGCTCCCTGGC CTCACTCAGCCCCCTGCCTGGACCCCTACTCAACCACAAGGCCCAGCTGCCATCATGGAA GCTGGCACCCAGAGGTACATGGCACCAGAGCTCTTGGACAAGACTCTGGACCTACAGGAT TGGGGCATGGCCCTCCGACGAGCTGATATTTACTCTTTGGCTCTGCTCCTGTGGGAGATA CTGAGCCGCTGCCCAGATTTGAGGCCTGCAGTCCACCACCCTTCCAACTGGCCTATGAGG CAGAACTGGGCAATACCCCTACCTCTGATGAGCTATGGGCCTTGGCAGTGCAGGAGAGGA GGCGTCCCTACATCCCATCCACCTGGCGCTGCTTTGCCACAGACCCTGATGGGC |
Restriction Sites | Please inquire |
ACCN | NM_001164690 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001164690.1, NP_001158162.1 |
RefSeq Size | 1859 bp |
RefSeq ORF | 1437 bp |
Locus ID | 269 |
UniProt ID | Q16671 |
Cytogenetics | 12q13.13 |
Protein Families | Druggable Genome, Protein Kinase, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction, TGF-beta signaling pathway |
Gene Summary | This gene encodes the receptor for the anti-Mullerian hormone (AMH) which, in addition to testosterone, results in male sex differentiation. AMH and testosterone are produced in the testes by different cells and have different effects. Testosterone promotes the development of male genitalia while the binding of AMH to the encoded receptor prevents the development of the mullerian ducts into uterus and Fallopian tubes. Mutations in this gene are associated with persistent Mullerian duct syndrome type II. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Sep 2009] Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region which results in a frameshift and early stop codon compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct C-terminus compared to isoform 1. Variants 2 and 3 encode isoforms that are the same length, but have distinct protein sequences. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228924 | AMHR2 (Myc-DDK-tagged)-Human anti-Mullerian hormone receptor, type II (AMHR2), transcript variant 2 |
USD 503.00 |
|
RC228924L1 | Lenti-ORF clone of AMHR2 (Myc-DDK-tagged)-Human anti-Mullerian hormone receptor, type II (AMHR2), transcript variant 2 |
USD 803.00 |
|
RC228924L2 | Lenti-ORF clone of AMHR2 (mGFP-tagged)-Human anti-Mullerian hormone receptor, type II (AMHR2), transcript variant 2 |
USD 803.00 |
|
RC228924L3 | Lenti-ORF clone of AMHR2 (Myc-DDK-tagged)-Human anti-Mullerian hormone receptor, type II (AMHR2), transcript variant 2 |
USD 803.00 |
|
RC228924L4 | Lenti-ORF clone of AMHR2 (mGFP-tagged)-Human anti-Mullerian hormone receptor, type II (AMHR2), transcript variant 2 |
USD 803.00 |
|
RG228924 | AMHR2 (tGFP-tagged) - Human anti-Mullerian hormone receptor, type II (AMHR2), transcript variant 2 |
USD 703.00 |
{0} Product Review(s)
Be the first one to submit a review