Cannabinoid Receptor I (CNR1) (NM_001160259) Human Untagged Clone

CAT#: SC327552

CNR1 (untagged)-Human cannabinoid receptor 1 (brain) (CNR1) transcript variant 5


  "NM_001160259" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


CNR1 rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "CNR1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CNR1
Synonyms CANN6; CB-R; CB1; CB1A; CB1K5; CB1R; CNR
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001160259, the custom clone sequence may differ by one or more nucleotides
ATGAAGTCGATCCTAGATGGCCTTGCAGATACCACCTTCCGCACCATCACCACTGACCTC
CTGTACGTGGGCTCAAATGACATTCAGTACGAAGACATCAAAGGTGACATGGCATCCAAA
TTAGGGTACTTCCCACAGAAATTCCCTTTAACTTCCTTTAGGGGAAGTCCCTTCCAAGAG
AAGATGACTGCGGGAGACAACCCCCAGCTAGTCCCAGCAGACCAGGTGAACATTACAGAA
TTTTACAACAAGTCTCTCTCGTCCTTCAAGGAGAATGAGGAGAACATCCAGTGTGGGGAG
AACTTCATGGACATAGAGTGTTTCATGGTCCTGAACCCCAGCCAGCAGCTGGCCATTGCA
GTCCTGTCCCTCACGCTGGGCACCTTCACGGTCCTGGAGAACCTCCTGGTGCTGTGCGTC
ATCCTCCACTCCCGCAGCCTCCGCTGCAGGCCTTCCTACCACTTCATCGGCAGCCTGGCG
GTGGCAGACCTCCTGGGGAGTGTCATTTTTGTCTACAGCTTCATTGACTTCCACGTGTTC
CACCGCAAAGATAGCCGCAACGTGTTTCTGTTCAAACTGGGTGGGGTCACGGCCTCCTTC
ACTGCCTCCGTGGGCAGCCTGTTCCTCACAGCCATCGACAGGTACATATCCATTCACAGG
CCCCTGGCCTATAAGAGGATTGTCACCAGGCCCAAGGCCGTGGTGGCGTTTTGCCTGATG
TGGACCATAGCCATTGTGATCGCCGTGCTGCCTCTCCTGGGCTGGAACTGCGAGAAACTG
CAATCTGTTTGCTCAGACATTTTCCCACACATTGATGAAACCTACCTGATGTTCTGGATC
GGGGTCACCAGCGTACTGCTTCTGTTCATCGTGTATGCGTACATGTATATTCTCTGGAAG
GCTCACAGCCACGCCGTCCGCATGATTCAGCGTGGCACCCAGAAGAGCATCATCATCCAC
ACGTCTGAGGATGGGAAGGTACAGGTGACCCGGCCAGACCAAGCCCGCATGGACATTAGG
TTAGCCAAGACCCTGGTCCTGATCCTGGTGGTGTTGATCATCTGCTGGGGCCCTCTGCTT
GCAATCATGGTGTATGATGTCTTTGGGAAGATGAACAAGCTCATTAAGACGGTGTTTGCA
TTCTGCAGTATGCTCTGCCTGCTGAACTCCACCGTGAACCCCATCATCTATGCTCTGAGG
AGTAAGGACCTGCGACACGCTTTCCGGAGCATGTTTCCCTCTTGTGAAGGCACTGCGCAG
CCTCTGGATAACAGCATGGGGGACTCGGACTGCCTGCACAAACACGCAAACAATGCAGCC
AGTGTTCACAGGGCCGCAGAAAGCTGCATCAAGAGCACGGTCAAGATTGCCAAGGTAACC
ATGTCTGTGTCCACAGACACGTCTGCCGAGGCTCTG
Restriction Sites Please inquire     
ACCN NM_001160259
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001160259.1, NP_001153731.1
RefSeq Size 5776 bp
RefSeq ORF 1419 bp
Locus ID 1268
UniProt ID P21554
Cytogenetics 6q15
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary This gene encodes one of two cannabinoid receptors. The cannabinoids, principally delta-9-tetrahydrocannabinol and synthetic analogs, are psychoactive ingredients of marijuana. The cannabinoid receptors are members of the guanine-nucleotide-binding protein (G-protein) coupled receptor family, which inhibit adenylate cyclase activity in a dose-dependent, stereoselective and pertussis toxin-sensitive manner. The two receptors have been found to be involved in the cannabinoid-induced CNS effects (including alterations in mood and cognition) experienced by users of marijuana. Multiple transcript variants encoding two different protein isoforms have been described for this gene. [provided by RefSeq, May 2009]
Transcript Variant: This variant (5) uses a different splice site in the 5' UTR, compared to variant 1. Variants 1, 3, 4 and 5 all encode isoform a. This variant was designated CB1D by PubMed ID: 15289816.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.