GM CSF Receptor alpha (CSF2RA) (NM_001161532) Human Untagged Clone

CAT#: SC327425

CSF2RA (untagged)-Human colony stimulating factor 2 receptor alpha low-affinity (granulocyte-macrophage) (CSF2RA) transcript variant 10

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CSF2RA
• Synonyms: alphaGMR; CD116; CDw116; CSF2R; CSF2RAX; CSF2RAY; CSF2RX; CSF2RY; GM-CSF-R-alpha; GMCSFR; GMCSFR-alpha; GMR; GMR-alpha; SMDP4
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001161532, the custom clone sequence may differ by one or more nucleotides
  ATGAACTGTACCTGGGCGAGGGGTCCGACGGCCCCCCGTGACGTCCAGTATTTTTTGTAC
  ATACGAAACTCAAAGAGAAGGAGGGAGATCCGGTGTCCTTATTACATACAAGACTCAGGA
  ACCCATGTGGGATGTCACCTGGATAACCTGTCAGGATTAACGTCTCGCAATTACTTTCTG
  GTTAACGGAACCAGCCGAGAAATTGGCATCCAATTCTTTGATTCACTTTTGGACACAAAG
  AAAATAGAACGATTCAACCCTCCCAGCAATGTCACCGTACGTTGCAACACGACGCACTGC
  CTCGTACGGTGGAAACAGCCCAGGACCTATCAGAAGCTGTCGTACCTGGACTTTCAGTAC
  CAGCTGGACGTCCACAGAAAGAATACCCAGCCTGGCACGGAAAACCTACTGATTAATGTT
  TCTGGTGATTTGGAAAATAGATACAACTTTCCAAGCTCTGAGCCCAGAGCAAAACACAGT
  GTGAAGATCAGAGCTGCAGACGTCCGCATCTTGAATTGGAGCTCCTGGAGTGAAGCCATT
  GAATTTGGTTCTGACGACGGGAACCTCGGCTCTGTGTACATTTATGTGCTCCTAATCGTG
  GGAACCCTTGTCTGTGGCATCGTCCTCGGCTTCCTCTTTAAAAGGTTCCTTAGGATACAG
  CGGCTGTTCCCGCCAGTTCCACAGATCAAAGACAAACTGAATGATAACCATGAGGTGGAA
  GACGAGATCATCTGGGAGGAATTCACCCCAGAGGAAGGGAAAGGCTACCGCGAAGAGGTC
  TTGACCGTGAAGGAAATTACC
  
• Restriction Sites: Please inquire
• ACCN: NM_001161532
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001161532.1, NP_001155004.1
• RefSeq Size: 1624 bp
• RefSeq ORF: 804 bp
• Locus ID: 1438
• UniProt ID: P15509
• Cytogenetics: X;Y
• Protein Families: Druggable Genome, Secreted Protein, Transmembrane
• Protein Pathways: Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, Jak-STAT signaling pathway, Pathways in cancer
• Gene Summary: The protein encoded by this gene is the alpha subunit of the heterodimeric receptor for colony stimulating factor 2, a cytokine which controls the production, differentiation, and function of granulocytes and macrophages. The encoded protein is a member of the cytokine family of receptors. This gene is found in the pseudoautosomal region (PAR) of the X and Y chromosomes. Multiple transcript variants encoding different isoforms have been found for this gene, with some of the isoforms being membrane-bound and others being soluble. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (10) lacks a 5' UTR exon and a coding exon in the 5' region, which results in a downstream AUG start codon, compared to variant 1. The resulting isoform (h) has a shorter N-terminus compared to isoform a.