Phospholipase A2 IIA (PLA2G2A) (NM_001161727) Human Untagged Clone
CAT#: SC327372
PLA2G2A (untagged)-Human phospholipase A2 group IIA (platelets synovial fluid) (PLA2G2A) transcript variant 2
"NM_001161727" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PLA2G2A |
Synonyms | MOM1; PLA2; PLA2B; PLA2L; PLA2S; PLAS1; sPLA2 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001161727, the custom clone sequence may differ by one or more nucleotides
ATGAAGACCCTCCTACTGTTGGCAGTGATCATGATCTTTGGCCTACTGCAGGCCCATGGG AATTTGGTGAATTTCCACAGAATGATCAAGTTGACGACAGGAAAGGAAGCCGCACTCAGT TATGGCTTCTACGGCTGCCACTGTGGCGTGGGTGGCAGAGGATCCCCCAAGGATGCAACG GATCGCTGCTGTGTCACTCATGACTGTTGCTACAAACGTCTGGAGAAACGTGGATGTGGC ACCAAATTTCTGAGCTACAAGTTTAGCAACTCGGGGAGCAGAATCACCTGTGCAAAACAG GACTCCTGCAGAAGTCAACTGTGTGAGTGTGATAAGGCTGCTGCCACCTGTTTTGCTAGA AACAAGACGACCTACAATAAAAAGTACCAGTACTATTCCAATAAACACTGCAGAGGGAGC ACCCCTCGTTGC |
Restriction Sites | Please inquire |
ACCN | NM_001161727 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001161727.1, NP_001155199.1 |
RefSeq Size | 986 bp |
RefSeq ORF | 435 bp |
Locus ID | 5320 |
UniProt ID | P14555 |
Cytogenetics | 1p36.13 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | alpha-Linolenic acid metabolism, Arachidonic acid metabolism, Ether lipid metabolism, Fc epsilon RI signaling pathway, Glycerophospholipid metabolism, GnRH signaling pathway, Linoleic acid metabolism, Long-term depression, MAPK signaling pathway, Metabolic pathways, Vascular smooth muscle contraction, VEGF signaling pathway |
Gene Summary | The protein encoded by this gene is a member of the phospholipase A2 family (PLA2). PLA2s constitute a diverse family of enzymes with respect to sequence, function, localization, and divalent cation requirements. This gene product belongs to group II, which contains secreted form of PLA2, an extracellular enzyme that has a low molecular mass and requires calcium ions for catalysis. It catalyzes the hydrolysis of the sn-2 fatty acid acyl ester bond of phosphoglycerides, releasing free fatty acids and lysophospholipids, and thought to participate in the regulation of the phospholipid metabolism in biomembranes. Several alternatively spliced transcript variants with different 5' UTRs have been found for this gene.[provided by RefSeq, Sep 2009] Transcript Variant: This variant (2) uses an alternate acceptor splice site at one of the 5' non-coding exons compared to variant 1. Variants 1-4 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228737 | PLA2G2A (Myc-DDK-tagged)-Human phospholipase A2, group IIA (platelets, synovial fluid) (PLA2G2A), transcript variant 2 |
USD 150.00 |
|
RC228737L3 | Lenti-ORF clone of PLA2G2A (Myc-DDK-tagged)-Human phospholipase A2, group IIA (platelets, synovial fluid) (PLA2G2A), transcript variant 2 |
USD 450.00 |
|
RC228737L4 | Lenti-ORF clone of PLA2G2A (mGFP-tagged)-Human phospholipase A2, group IIA (platelets, synovial fluid) (PLA2G2A), transcript variant 2 |
USD 450.00 |
|
RG228737 | PLA2G2A (tGFP-tagged) - Human phospholipase A2, group IIA (platelets, synovial fluid) (PLA2G2A), transcript variant 2 |
USD 350.00 |
{0} Product Review(s)
Be the first one to submit a review