TRIP13 (NM_001166260) Human Untagged Clone

CAT#: SC326859

TRIP13 (untagged)-Human thyroid hormone receptor interactor 13 (TRIP13) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TRIP13
• Synonyms: 16E1BP; MVA3; OOMD9
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC326859 representing NM_001166260.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGACGAGGCCGTGGGCGACCTGAAGCAGGCGCTTCCCTGTGTGGCCGAGTCGCCAACGGTCCACGTG
  GAGGTGCATCAGCGCGGCAGCAGCACTGCAAAGAAAGAAGACATAAACCTGAGTGTTAGAAAGCTACTC
  AACAGACATAATATTGTGTTTGGTGATTACACATGGACTGAGTTTGATGAACCTTTTTTGACCAGAAAT
  GTGCAGTCTGTGTCTATTATTGACACAGAATTAAAGGTTAAAGACTCACAGCCCATCGATTTGAGTGCA
  TGCACTGTTGCACTTCACATTTTCCAGCTGAATGAAGATGGCCCCAGCAGTGAAAATCTGGAGGAAGAG
  ACAGAAAACATAATTGCAGCAAATCACTGGGTTCTACCTGCAGCTGAATTCCATGGGCTTTGGGACAGC
  TTGGTATACGATGTGGAAGTCAAATCCCATCTCCTCGATTATGTGATGACAACTTTACTGTTTTCAGAC
  AAGAACGTCAACAGCAACCTCATCACCTGGAACCGGGTGGTGCTGCTCCACGGTCCTCCTGGCACTGGA
  AAAACATCCCTGTGTAAAGCGTTAGCCCAGAAATTGACAATTAGACTTTCAAGCAGGTACCGATATGGC
  CAATTAATTGAAATAAACAGCCACAGCCTCTTTTCTAAGTGGTTTTCGGAAAGTGGCAAGCTGGTAACC
  AAGATGTTTCAGAAGATTCAGGATTTGATTGATGATAAAGACGCCCTGGTGTTCGTGCTGATTGATGAG
  GTGGAGAGTCTCACAGCCGCCCGAAATGCCTGCAGGGCGGGCACCGAGCCATCAGATGCCATCCGCGTG
  GTCAATGCTGTCTTGACCCAAATTGATCAGATTAAAAGGTAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001166260
• Insert Size: 870 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001166260.1
• RefSeq Size: 1482 bp
• RefSeq ORF: 870 bp
• Locus ID: 9319
• Cytogenetics: 5p15.33
• Protein Families: Druggable Genome, Stem cell - Pluripotency, Transcription Factors
• MW: 32.4 kDa
• Gene Summary: This gene encodes a protein that interacts with thyroid hormone receptors, also known as hormone-dependent transcription factors. The gene product interacts specifically with the ligand binding domain. This gene is one of several that may play a role in early-stage non-small cell lung cancer. [provided by RefSeq, Oct 2009]
  Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, compared to variant 1. It encodes isoform 2, which has a shorter and distinct C-terminus, compared to isoform 1.