RBM34 (NM_001161533) Human Untagged Clone
CAT#: SC326790
RBM34 (untagged)-Human RNA binding motif protein 34 (RBM34) transcript variant 2
"NM_001161533" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RBM34 |
Synonyms | KIAA0117 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001161533, the custom clone sequence may differ by one or more nucleotides
ATGGCCTTGGAAGGGATGAGCAAACGGAAGAGAAAGAGAAGTGTCCAGGAGGGAGAGAAT CCTGACGACGGCGTTCGCGGGAGTCCGCCGGAAGACTACAGGCTTGGACAGGTCGCCAGT AGCTTATTTCGCGGCGAACACCATTCCAGAGGTGGCACCGGTCGGCTGGCGTCCCTCTTC AGTTCTCTGGAGCCCCAGATTCAACCCGTGTACGTGCCTGTGCCTAAACAAACCATCAAA AAAACGAAACGGAATGAGGAGGAAGAAAGTACATCCCAGATTGAAAGACCACTTTCGCAA GAACCTGCCAAAAAAGTGAAAGCGAAGAAGAAACACACTAACGCAGAAAAAAAGTTGGCA GACAGGGAAAGCGCTCTAGCGAGTGCTGATTTAGAAGAAGAAATTCACCAGAAACAAGGG CAGAAAAGGAAAAATTCTCAACCTGGTGTTAAAGTAGCAGATAGAAAAATACTTGATGAC ACAGAAGACACAGTTGTCAGTCAAAGAAAGAAAATTCAAATCAACCAAGAAGAAGAGAGA TTAAAGAATGAGAGAACTGTGTTTGTTGGGAATTTGCCTGTTACATGTAATAAGAAGAAG CTGAAGTCGTTTTTTAAAGAGTATGGACAAATAGAATCTGTACGATTTCGTTCTCTGGTA TGTTTCATTCCCCCG |
Restriction Sites | Please inquire |
ACCN | NM_001161533 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001161533.1, NP_001155005.1 |
RefSeq Size | 905 bp |
RefSeq ORF | 678 bp |
Locus ID | 23029 |
Cytogenetics | 1q42.3 |
Gene Summary | This gene encodes a member of the RNA-binding motif family of RNA recognition motif proteins. The encoded protein contains an RNA-binding domain made up of two RNA recognition motif subdomains referred to as RNA recognition motif-1 and RNA recognition motif-2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016] Transcript Variant: This variant (2) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228155 | RBM34 (Myc-DDK-tagged)-Human RNA binding motif protein 34 (RBM34), transcript variant 2 |
USD 330.00 |
|
RC228155L3 | Lenti-ORF clone of RBM34 (Myc-DDK-tagged)-Human RNA binding motif protein 34 (RBM34), transcript variant 2 |
USD 630.00 |
|
RC228155L4 | Lenti-ORF clone of RBM34 (mGFP-tagged)-Human RNA binding motif protein 34 (RBM34), transcript variant 2 |
USD 630.00 |
|
RG228155 | RBM34 (tGFP-tagged) - Human RNA binding motif protein 34 (RBM34), transcript variant 2 |
USD 530.00 |
{0} Product Review(s)
Be the first one to submit a review