RPS20 (NM_001146227) Human Untagged Clone

CAT#: SC326715

RPS20 (untagged)-Human ribosomal protein S20 (RPS20) transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RPS20
• Synonyms: S20; uS10
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC326715 representing NM_001146227.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCTTTTAAGGATACCGGAAAAACACCCGTGGAGCCGGAGGTGGCAATTCACCGAATTCGAATCACC
  CTAACAAGCCGCAACGTAAAATCCTTGGAAAAGGTGTGTGCTGACTTGATAAGAGGCGCAAAAGAAAAG
  AATCTCAAAGTGAAAGGACCAGTTCGAATGCCTACCAAGACTTTGAGAATCACTACAAGAAAAACTCCT
  TGTGGTGAAGGTTCTAAGACGTGGGATCGTTTCCAGATGAGAATTCACAAGCGACTCATTGACTTGCAC
  AGTCCTTCTGAGATTGTTAAGCAGATTACTTCCATCAGTATTGAGCCAGGAGTTGAGTTGATCGAATCT
  ACAGATGCAGAACCCATGGATACAGAGGGCCAGCAGTACACTTTGAGAAGTGTATTCGAATCCCCGGGG
  ACATGTCCTTTTTAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001146227
• Insert Size: 429 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001146227.1
• RefSeq Size: 1013 bp
• RefSeq ORF: 429 bp
• Locus ID: 6224
• UniProt ID: P60866
• Cytogenetics: 8q12.1
• Protein Pathways: Ribosome
• MW: 16 kDa
• Gene Summary: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S10P family of ribosomal proteins. It is located in the cytoplasm. This gene is co-transcribed with the small nucleolar RNA gene U54, which is located in its second intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Two transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Apr 2009]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).