NONO (NM_001145408) Human Untagged Clone

CAT#: SC326483

NONO (untagged)-Human non-POU domain containing, octamer-binding (NONO), transcript variant 1, mRNA


  "NM_001145408" in other vectors (6)

Reconstitution Protocol

USD 732.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
NONO mouse monoclonal antibody, clone OTI4D9 (formerly 4D9)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "NONO"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NONO
Synonyms MRXS34; NMT55; NRB54; P54; P54NRB; PPP1R114
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC326483 representing NM_001145408.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGAGTAATAAAACTTTTAACTTGGAGAAGCAAAACCATACTCCAAGAAAGCATCATCAACATCAC
CACCAGCAGCAGCACCACCAGCAGCAACAGCAGCAGCCGCCACCACCGCCAATACCTGCAAATGGGCAA
CAGGCCAGCAGCCAAAATGAAGGCTTGACTATTGACCTGAAGAATTTTAGAAAACCAGGAGAGAAGACC
TTCACCCAACGAAGCCGTCTTTTTGTGGGAAATCTTCCTCCCGACATCACTGAGGAAGAAATGAGGAAA
CTATTTGAGAAATATGGAAAGGCAGGCGAAGTCTTCATTCATAAGGATAAAGGATTTGGCTTTATCCGC
TTGGAAACCCGAACCCTAGCGGAGATTGCCAAAGTGGAGCTGGACAATATGCCACTCCGTGGAAAGCAG
CTGCGTGTGCGCTTTGCCTGCCATAGTGCATCCCTTACAGTTCGAAACCTTCCTCAGTATGTGTCCAAC
GAACTGCTGGAAGAAGCCTTTTCTGTGTTTGGCCAGGTAGAGAGGGCTGTAGTCATTGTGGATGATCGA
GGAAGGCCCTCAGGAAAAGGCATTGTTGAGTTCTCAGGGAAGCCAGCTGCTCGGAAAGCTCTGGACAGA
TGCAGTGAAGGCTCCTTCCTGCTAACCACATTTCCTCGTCCTGTGACTGTGGAGCCCATGGACCAGTTA
GATGATGAAGAGGGACTTCCAGAGAAGCTGGTTATAAAAAACCAGCAATTTCACAAGGAACGAGAGCAG
CCACCCAGATTTGCACAGCCTGGCTCCTTTGAGTATGAATATGCCATGCGCTGGAAGGCACTCATTGAG
ATGGAGAAGCAGCAGCAGGACCAAGTGGACCGCAACATCAAGGAGGCTCGTGAGAAGCTGGAGATGGAG
ATGGAAGCTGCACGCCATGAGCACCAGGTCATGCTAATGAGACAGGATTTGATGAGGCGCCAAGAAGAA
CTTCGGAGGATGGAAGAGCTGCACAACCAAGAGGTGCAAAAACGAAAGCAACTGGAGCTCAGGCAGGAG
GAAGAGCGCAGGCGCCGTGAAGAAGAGATGCGGCGGCAGCAAGAAGAAATGATGCGGCGACAGCAGGAA
GGATTCAAGGGAACCTTCCCTGATGCGAGAGAGCAGGAGATTCGGATGGGTCAGATGGCTATGGGAGGT
GCTATGGGCATAAACAACAGAGGTGCCATGCCCCCTGCTCCTGTGCCAGCTGGTACCCCAGCTCCTCCA
GGACCTGCCACTATGATGCCGGATGGAACTTTGGGATTGACCCCACCAACAACTGAACGCTTTGGTCAG
GCTGCTACAATGGAAGGAATTGGGGCAATTGGTGGAACTCCTCCTGCATTCAACCGTGCAGCTCCTGGA
GCTGAATTTGCCCCAAACAAACGTCGCCGATACTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001145408
Insert Size 1416 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001145408.1
RefSeq Size 3228 bp
RefSeq ORF 1416 bp
Locus ID 4841
UniProt ID Q15233
Cytogenetics Xq13.1
Protein Families Druggable Genome, Transcription Factors
MW 54.2 kDa
Gene Summary This gene encodes an RNA-binding protein which plays various roles in the nucleus, including transcriptional regulation and RNA splicing. A rearrangement between this gene and the transcription factor E3 gene has been observed in papillary renal cell carcinoma. Alternatively spliced transcript variants have been described. Pseudogenes exist on Chromosomes 2 and 16. [provided by RefSeq, Feb 2009]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.