COCH (NM_001135058) Human Untagged Clone

CAT#: SC326061

COCH (untagged)-Human coagulation factor C homolog, cochlin (Limulus polyphemus) (COCH), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: COCH
• Synonyms: COCH-5B2; COCH5B2; DFNA9; DFNB110
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001135058, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCGCAGCCTGGATCCCGGCTCTCGGCCTCGGTGTGTGTCTGCTGCTGCTGCCGGGGCCCGCGGGCA
  GCGAGGGAGCCGCTCCCATTGCTATCACATGTTTTACCAGAGGCTTGGACATCAGGAAAGAGAAAGCAGA
  TGTCCTCTGCCCAGGGGGCTGCCCTCTTGAGGAATTCTCTGTGTATGGGAACATAGTATATGCTTCTGTA
  TCGAGCATATGTGGGGCTGCTGTCCACAGGGGAGTAATCAGCAACTCAGGGGGACCTGTACGAGTCTATA
  GCCTACCTGGTCGAGAAAACTATTCCTCAGTAGATGCCAATGGCATCCAGTCTCAAATGCTTTCTAGATG
  GTCTGCTTCTTTCACAGTAACTAAAGGCAAAAGTAGTACACAGGAGGCCACAGGACAAGCAGTGTCCACA
  GCACATCCACCAACAGGTAAACGACTAAAGAAAACACCCGAGAAGAAAACTGGCAATAAAGATTGTAAAG
  CAGACATTGCATTTCTGATTGATGGAAGCTTTAATATTGGGCAGCGCCGATTTAATTTACAGAAGAATTT
  TGTTGGAAAAGTGGCTCTAATGTTGGGAATTGGAACAGAAGGACCACATGTGGGCCTTGTTCAAGCCAGT
  GAACATCCCAAAATAGAATTTTACTTGAAAAACTTTACATCAGCCAAAGATGTTTTGTTTGCCATAAAGG
  AAGTAGGTTTCAGAGGGGGTAATTCCAATACAGGAAAAGCCTTGAAGCATACTGCTCAGAAATTCTTCAC
  GGTAGATGCTGGAGTAAGAAAAGGGATCCCCAAAGTGGTGGTGGTATTTATTGATGGTTGGCCTTCTGAT
  GACATCGAGGAAGCAGGCATTGTGGCCAGAGAGTTTGGTGTCAATGTATTTATAGTTTCTGTGGCCAAGC
  CTATCCCTGAAGAACTGGGGATGGTTCAGGATGTCACATTTGTTGACAAGGCTGTCTGTCGGAATAATGG
  CTTCTTCTCTTACCACATGCCCAACTGGTTTGGCACCACAAAATACGTAAAGCCTCTGGTACAGAAGCTG
  TGCACTCATGAACAAATGATGTGCAGCAAGACCTGTTATAACTCAGTGAACATTGCCTTTCTAATTGATG
  GCTCCAGCAGTGTTGGAGATAGCAATTTCCGCCTCATGCTTGAATTTGTTTCCAACATAGCCAAGACTTT
  TGAAATCTCGGACATTGGTGCCAAGATAGCTGCTGTACAGTTTACTTATGATCAGCGCACGGAGTTCAGT
  TTCACTGACTATAGCACCAAAGAGAATGTCCTAGCTGTCATCAGAAACATCCGCTATATGAGTGGTGGAA
  CAGCTACTGGTGATGCCATTTCCTTCACTGTTAGAAATGTGTTTGGCCCTATAAGGGAGAGCCCCAACAA
  GAACTTCCTAGTAATTGTCACAGATGGGCAGTCCTATGATGATGTCCAAGGCCCTGCAGCTGCTGCACAT
  GATGCAGGAATCACTATCTTCTCTGTTGGTGTGGCTTGGGCACCTCTGGATGACCTGAAAGATATGGCTT
  CTAAACCGAAGGAGTCTCATGCTTTCTTCACAAGAGAGTTCACAGGATTAGAACCAATTGTTTCTGATGT
  CATCAGAGGCATTTGTAGAGATTTCTTAGAATCCCAGCAATAA
  
  
• Restriction Sites: Please inquire
• ACCN: NM_001135058
• Insert Size: 2100 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001135058.1, NP_001128530.1
• RefSeq Size: 2882 bp
• RefSeq ORF: 1653 bp
• Locus ID: 1690
• UniProt ID: O43405
• Cytogenetics: 14q12
• Gene Summary: The protein encoded by this gene is highly conserved in human, mouse, and chicken, showing 94% and 79% amino acid identity of human to mouse and chicken sequences, respectively. Hybridization to this gene was detected in spindle-shaped cells located along nerve fibers between the auditory ganglion and sensory epithelium. These cells accompany neurites at the habenula perforata, the opening through which neurites extend to innervate hair cells. This and the pattern of expression of this gene in chicken inner ear paralleled the histologic findings of acidophilic deposits, consistent with mucopolysaccharide ground substance, in temporal bones from DFNA9 (autosomal dominant nonsyndromic sensorineural deafness 9) patients. Mutations that cause DFNA9 have been reported in this gene. Alternative splicing results in multiple transcript variants encoding the same protein. Additional splice variants encoding distinct isoforms have been described but their biological validities have not been demonstrated. [provided by RefSeq, Oct 2008]
  Transcript Variant: This variant (1) uses an alternate in-frame splice junction in the 5' end compared to variant 3. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. Variants 1 and 2 encode the same isoform (b).