PPHLN1 (NM_001143788) Human Untagged Clone
CAT#: SC325803
PPHLN1 (untagged)-Human periphilin 1 (PPHLN1), transcript variant 7
"NM_001143788" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PPHLN1 |
Synonyms | CR; HSPC206; HSPC232 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001143788, the custom clone sequence may differ by one or more nucleotides
ATGTGGTCTGAGGGACGATATGAATATGAAAGAATTCCGAGAGAACGAGCACCTCCTCGA AGTCATCCCAGTGATGGCTACAATAGACTAGTTAATATTGTGCCAAAGAAACCACCACTG CTAGACAGACCTGGTGAAGGAAGCTACAATAGATATTACAGTCATGTTGATTACCGAGAC TATGACGAGGGCCGCAGTTTTTCTCATGATCGAAGAAGTGGTCCACCTCACAGAGGAGAT GAATCTGGTTATAGATGGACAAGAGACGATCATTCTGCAAGCAGGCAACCTGAATACAGG GACATGAGAGATGGCTTTAGAAGAAAAAGTTTCTACTCTTCCCATTATGCGAGAGAGCGG TCTCCTTATAAAAGGGACAATACTTTTTTCAGAGAATCACCTGTTGGCCGAAAGGATTCT CCACACAGCAGATCTGGTTCCAGTGTCAGTAGCAGAAGCTACTCTCCAGAAAGGAGCAAA TCATACTCTTTCCATCAGTCTCAACATAGAAATAAAGAGAGGCCTGTCCAGTCTTTGAAA ACATCAAGAGATACTTCACCCTCAAGTGGTTCAGCAGTTTCTTCATCAAAGGTGTTAGAC AAACCCAGTAGGCTAACTGAAAAGGAACTTGCTGAGGCTGCAAGCAAGTGGGCTGCTGAA AAGCTAGAGAAATCAGATGAAAGTAACTTGCCTGAAATTTCTGAGTATGAGGCGGGATCC ACAGCACCATTGTTTACTGACCAGCCAGAGGAACCTGAGTCAAACACAACACATGGGATA GAATTATTTGAAGATAGTCAGCTAACCACTCGCTCTAAAGCAATAGCATCAAAAACCAAA GAGATTGAACAGGTTTACCGACAAGACTGTGAAACTTTCGGGATGGTGGTGAAAATGCTG ATTGAAAAAGATCCTTCATTAGAAAAGTCTATACAGTTTGCATTGAGGCAGAATTTACAT GAAATAGGTGAGCGGTGTGTTGAAGAACTCAAGCATTTCATTGCAGAGTATGATACTTCC ACTCAAGATTTTGGAGAGCCTTTT |
Restriction Sites | Please inquire |
ACCN | NM_001143788 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001143788.1, NP_001137260.1 |
RefSeq Size | 1620 bp |
RefSeq ORF | 1047 bp |
Locus ID | 51535 |
UniProt ID | Q8NEY8 |
Cytogenetics | 12q12 |
Gene Summary | The protein encoded by this gene is one of the several proteins that become sequentially incorporated into the cornified cell envelope during the terminal differentiation of keratinocyte at the outer layers of epidermis. This protein interacts with periplakin, which is known as a precursor of the cornified cell envelope. The cellular localization pattern and insolubility of this protein suggest that it may play a role in epithelial differentiation and contribute to epidermal integrity and barrier formation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (7) lacks an alternate in-frame exon and has multiple differences in the 3' region when compared to variant 1. The resulting isoform (7) has a distinct and shorter C-terminus and lacks an internal segment compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227683 | PPHLN1 (Myc-DDK-tagged)-Human periphilin 1 (PPHLN1), transcript variant 7 |
USD 457.00 |
|
RC227683L3 | Lenti-ORF clone of PPHLN1 (Myc-DDK-tagged)-Human periphilin 1 (PPHLN1), transcript variant 7 |
USD 757.00 |
|
RC227683L4 | Lenti-ORF clone of PPHLN1 (mGFP-tagged)-Human periphilin 1 (PPHLN1), transcript variant 7 |
USD 757.00 |
|
RG227683 | PPHLN1 (tGFP-tagged) - Human periphilin 1 (PPHLN1), transcript variant 7 |
USD 657.00 |
{0} Product Review(s)
Be the first one to submit a review