PHPT1 (NM_001135861) Human Untagged Clone
CAT#: SC325483
PHPT1 (untagged)-Human phosphohistidine phosphatase 1 (PHPT1), transcript variant 2
"NM_001135861" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PHPT1 |
Synonyms | CGI-202; HEL-S-132P; HSPC141; PHP; PHP14 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001135861, the custom clone sequence may differ by one or more nucleotides
ATGGCGGTGGCGGACCTCGCTCTCATTCCTGATGTGGACATCGACTCCGACGGCGTCTTC AAGTATGTGCTGATCCGAGTCCACTCGGCTCCCCGCTCCGGGGCTCCGGCTGCAGAGAGC AAGGAGATCGTGCGCGGCTACAAGTGGGCTGAGTACCATGCGGACATCTACGACAAAGTG TCGGGCGACATGCAGAAGCAAGGCTGCGACTGTGAGTGTCTGGGCGGCGGGCGCATCTCC CACCAGAGTCAGGACAAGAAGATTCACGTGTACGGCTATTCCATGATGAGACCCACGTGC GTCCCTCTGGGCGCCTCAGGCCCCAGGATCCACCATCAAGGCCTATGGTCCTGCCCAGCA CGCCATTTCAAC |
Restriction Sites | Please inquire |
ACCN | NM_001135861 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001135861.1, NP_001129333.1 |
RefSeq Size | 1273 bp |
RefSeq ORF | 375 bp |
Locus ID | 29085 |
UniProt ID | Q9NRX4 |
Cytogenetics | 9q34.3 |
Protein Families | Druggable Genome |
Protein Pathways | Fructose and mannose metabolism, Metabolic pathways, Riboflavin metabolism, Thiamine metabolism |
Gene Summary | This gene encodes an enzyme that catalyzes the reversible dephosphorylation of histidine residues in proteins. It may be involved in the dephosphorylation of G-beta and ATP citrate lyase and in negatively regulating CD4 T lymphocytes by dephosphorylation and inhibition of KCa3.1 channels. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region and includes an alternate exon in the 3' coding region, compared to variant 4. This results in a frameshift and an early stop codon. It encodes isoform 2, which is shorter and has a distinct C-terminus, compared to isoform 4. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227330 | PHPT1 (Myc-DDK-tagged)-Human phosphohistidine phosphatase 1 (PHPT1), transcript variant 2 |
USD 165.00 |
|
RC227330L3 | Lenti-ORF clone of PHPT1 (Myc-DDK-tagged)-Human phosphohistidine phosphatase 1 (PHPT1), transcript variant 2 |
USD 465.00 |
|
RC227330L4 | Lenti-ORF clone of PHPT1 (mGFP-tagged)-Human phosphohistidine phosphatase 1 (PHPT1), transcript variant 2 |
USD 465.00 |
|
RG227330 | PHPT1 (tGFP-tagged) - Human phosphohistidine phosphatase 1 (PHPT1), transcript variant 2 |
USD 365.00 |
{0} Product Review(s)
Be the first one to submit a review