FKBP2 (NM_001135208) Human Untagged Clone

CAT#: SC324731

FKBP2 (untagged)-Human FK506 binding protein 2, 13kDa (FKBP2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FKBP2
• Synonyms: FKBP-13; FKBP13; PPIase
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC324731 representing NM_001135208.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAGGCTGAGCTGGTTCCGGGTCCTGACAGTACTGTCCATCTGCCTGAGCGCCGTGGCCACGGCCACG
  GGGGCCGAGGGCAAAAGGAAGCTGCAGATCGGGGTCAAGAAGCGGGTGGACCACTGTCCCATCAAATCG
  CGCAAAGGGGATGTCCTGCACATGCACTACACGGGGAAGCTGGAAGATGGGACAGAGTTTGACAGCAGC
  CTGCCCCAGAACCAGCCCTTTGTCTTCTCCCTTGGCACAGGCCAGGTCATCAAGGGCTGGGACCAGGGG
  CTGCTGGGGATGTGTGAGGGGGAAAAGCGCAAGCTGGTGATCCCATCCGAGCTAGGGTATGGAGAGCGG
  GGAGCTCCCCCAAAGATTCCAGGCGGTGCAACCCTGGTGTTCGAGGTGGAGCTGCTCAAAATAGAGCGA
  CGAACTGAGCTGTAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001135208
• Insert Size: 429 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001135208.1
• RefSeq Size: 662 bp
• RefSeq ORF: 429 bp
• Locus ID: 2286
• UniProt ID: P26885
• Cytogenetics: 11q13.1
• Protein Families: Druggable Genome
• MW: 15.6 kDa
• Gene Summary: The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. It is thought to function as an ER chaperone and may also act as a component of membrane cytoskeletal scaffolds. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2008]
  Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1 through 6 encode the same isoform.