Macrophage Inflammatory Protein 3 alpha (CCL20) (NM_001130046) Human Untagged Clone

CAT#: SC322804

CCL20 (untagged)-Human chemokine (C-C motif) ligand 20 (CCL20), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: Macrophage Inflammatory Protein 3 alpha
• Synonyms: CKb4; Exodus; LARC; MIP-3-alpha; MIP-3a; MIP3A; SCYA20; ST38
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_001130046 edited
  AGAATATAACAGCACTCCCAAAGAACTGGGTACTCAACACTGAGCAGATCTGTTCTTTGA
  GCTAAAAACCATGTGCTGTACCAAGAGTTTGCTCCTGGCTGCTTTGATGTCAGTGCTGCT
  ACTCCACCTCTGCGGCGAATCAGAAGCAAGCAACTTTGACTGCTGTCTTGGATACACAGA
  CCGTATTCTTCATCCTAAATTTATTGTGGGCTTCACACGGCAGCTGGCCAATGAAGGCTG
  TGACATCAATGCTATCATCTTTCACACAAAGAAAAAGTTGTCTGTGTGCGCAAATCCAAA
  ACAGACTTGGGTGAAATATATTGTGCGTCTCCTCAGTAAAAAAGTCAAGAACATGTAAAA
  ACTGTGGCTTTTCTGGAATGGAATTGGACATAGCCCAAGAACAGAAAGAACCTTGCTGGG
  GTTGGAGGTTTCACTTGCACATCATGGAGGGTTTAGTGCTTATCTAATTTGTGCCTCACT
  GGACTTGTCCAATTAATGAAGTTGATTCATATTGCATCATAGTTTGCTTTGTTTAAGCAT
  CACATTAAAGTTAAACTGTATTTTATGTTATTTATAGCTGTAGGTTTTCTGTGTTTAGCT
  ATTTAATACTAATTTTCCATAAGCTATTTTGGTTTAGTGCAAAGTATAAAATTATATTTG
  GGGGGGAATAAGATTATATGGACTTTCTTGCAAGCAACAAGCTATTTTTTAAAAAAACTA
  TTTAACATTCTTTTGTTTATATTGTTTTGTCTCCTAAATTGTTGTAATTGCATTATAAAA
  TAAGAAAAATATTAATAAGACAAATATTGAAAATAAAGAAACAAAAAGCTAAAAAAAAAA
  AAAAAAAAAAAAAAAAAAAA
  
• Restriction Sites: Please inquire
• ACCN: NM_001130046
• Insert Size: 1000 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001130046.1, NP_001123518.1
• RefSeq Size: 848 bp
• RefSeq ORF: 288 bp
• Locus ID: 6364
• UniProt ID: P78556
• Cytogenetics: 2q36.3
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Chemokine signaling pathway, Cytokine-cytokine receptor interaction
• Gene Summary: This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The protein encoded by this gene displays chemotactic activity for lymphocytes and can repress proliferation of myeloid progenitors. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]
  Transcript Variant: This variant (2) uses an alternate splice site in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.