PPAP2C (PLPP2) (NM_003712) Human Untagged Clone

CAT#: SC320713

PPAP2C (untagged)-Human phosphatidic acid phosphatase type 2C (PPAP2C), transcript variant 1


  "NM_003712" in other vectors (5)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


PLPP2 rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "PPAP2C"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PPAP2C
Synonyms LPP2; PAP-2c; PAP2-g; PPAP2C
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_003712.2 CCGGGACGCGACGGGACGCGCTGGGACCGGCGTCGGGGGTCGCGGGGACCATGCAGCGGA
GGTGGGTCTTCGTGCTGCTCGACGTGCTGTGCTTACTGGTCGCCTCCCTGCCCTTCGCTA
TCCTGACGCTGGTGAACGCCCCGTACAAGCGAGGATTTTACTGCGGGGATGACTCCATCC
GGTACCCCTACCGTCCAGATACCATCACCCACGGGCTCATGGCTGGGGTCACCATCACGG
CCACCGTCATCCTTGTCTCGGCCGGGGAAGCCTACCTGGTGTACACAGACCGGCTCTATT
CTCGCTCGGACTTCAACAACTACGTGGCTGCTGTATACAAGGTGCTGGGGACCTTCCTGT
TTGGGGCTGCCGTGAGCCAGTCTCTGACAGACCTGGCCAAGTACATGATTGGGCGTCTGA
GGCCCAACTTCCTAGCCGTCTGCGACCCCGACTGGAGCCGGGTCAACTGCTCGGTCTATG
TGCAGCTGGAGAAGGTGTGCAGGGGAAACCCTGCTGATGTCACCGAGGCCAGGTTGTCTT
TCTACTCGGGACACTCTTCCTTTGGGATGTACTGCATGGTGTTCTTGGCGCTGTATGTGC
AGGCACGACTCTGTTGGAAGTGGGCACGGCTGCTGCGACCCACAGTCCAGTTCTTCCTGG
TGGCCTTTGCCCTCTACGTGGGCTACACCCGCGTGTCTGATTACAAACACCACTGGAGCG
ATGTCCTTGTTGGCCTCCTGCAGGGGGCACTGGTGGCTGCCCTCACTGTCTGCTACATCT
CAGACTTCTTCAAAGCCCGACCCCCACAGCACTGTCTGAAGGAGGAGGAGCTGGAACGGA
AGCCCAGCCTGTCACTGACGTTGACCCTGGGCGAGGCTGACCACAACCACTATGGATACC
CGCACTCCTCCTCCTGAGGCCGGACCCCGCCCAGGCAGGGAGCTACTGTGAGTCCAGCTG
AGGCCCACCCAGGTGGTCCCTCCAGCCCTGGTTAGGCACTGAGGGCTCTGGACGGGCTCC
AGGAACCCTGGGCTGATGGGAGCAGTGAGCGGGCTCCGCTGCCCCCTGCCCTGCACTGGA
CCAGGAGTCTGGAGATGCCTGGGTAGCCCTCAGCATTTGGAGGGGAACCTGTTCCCGTCG
GTCCCCAAATATCCCCTTCTTTTTATGGGGTTAAGGAAGGGACCGAGAGATCAGATAGTT
GCTGTTTTGTAAAATGTAATGTATATGTGGTTTTTAGTAAAATAGGGCACCTGTTTCAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_003712
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_003712.2, NP_003703.1
RefSeq Size 1327 bp
RefSeq ORF 867 bp
Locus ID 8612
UniProt ID O43688
Cytogenetics 19p13.3
Domains acidPPc
Protein Families Druggable Genome, Stem cell - Pluripotency, Transmembrane
Protein Pathways Ether lipid metabolism, Fc gamma R-mediated phagocytosis, Glycerolipid metabolism, Glycerophospholipid metabolism, Metabolic pathways, Sphingolipid metabolism
Gene Summary The protein encoded by this gene is a member of the phosphatidic acid phosphatase (PAP) family. PAPs convert phosphatidic acid to diacylglycerol, and function in de novo synthesis of glycerolipids as well as in receptor-activated signal transduction mediated by phospholipase D. This protein is similar to phosphatidic acid phosphatase type 2A (PPAP2A) and type 2B (PPAP2B). All three proteins contain 6 transmembrane regions, and a consensus N-glycosylation site. This protein has been shown to possess membrane associated PAP activity. Three alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) differs in the 5' region, including the 5' UTR and 5' coding region, as compared to variant 3. The resulting isoform (1) has a distinct and shorter N-terminus, as compared to isoform 3.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.